ID: 1030550189

View in Genome Browser
Species Human (GRCh38)
Location 7:110948837-110948859
Sequence GATGATGCCCGTCCACGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 5, 3: 101, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030550189_1030550194 -4 Left 1030550189 7:110948837-110948859 CCTCAACGTGGACGGGCATCATC 0: 1
1: 0
2: 5
3: 101
4: 480
Right 1030550194 7:110948856-110948878 CATCCAATGAGCTGGGGGCTTGG No data
1030550189_1030550192 -10 Left 1030550189 7:110948837-110948859 CCTCAACGTGGACGGGCATCATC 0: 1
1: 0
2: 5
3: 101
4: 480
Right 1030550192 7:110948850-110948872 GGGCATCATCCAATGAGCTGGGG No data
1030550189_1030550193 -9 Left 1030550189 7:110948837-110948859 CCTCAACGTGGACGGGCATCATC 0: 1
1: 0
2: 5
3: 101
4: 480
Right 1030550193 7:110948851-110948873 GGCATCATCCAATGAGCTGGGGG 0: 1
1: 1
2: 31
3: 145
4: 869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030550189 Original CRISPR GATGATGCCCGTCCACGTTG AGG (reversed) Intronic