ID: 1030551264

View in Genome Browser
Species Human (GRCh38)
Location 7:110963394-110963416
Sequence GTCCATGAGGGCCAAAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030551264_1030551267 5 Left 1030551264 7:110963394-110963416 CCAAAACTTTGGCCCTCATGGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1030551267 7:110963422-110963444 ATGTATTTCCCAAGTAATGTAGG 0: 1
1: 0
2: 2
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030551264 Original CRISPR GTCCATGAGGGCCAAAGTTT TGG (reversed) Intronic
903372047 1:22842639-22842661 GGCCATGGGGCCCACAGTTTTGG + Intronic
908908394 1:69042978-69043000 GTCCATGAGGTCAAATGTTTTGG - Intergenic
911510841 1:98806084-98806106 GTCCGTGAGGGCCGGAGTTTTGG + Intergenic
913162086 1:116153612-116153634 CTCCATGAAGGCCACAGCTTTGG - Intergenic
918373826 1:183888500-183888522 CTCCTTGAGGGCCATCGTTTCGG + Exonic
919477454 1:198046699-198046721 CTTCATGAGGACCATAGTTTTGG - Intergenic
924553137 1:245097122-245097144 GTCCCTGAGGTCACAAGTTTAGG - Intronic
1063218485 10:3944780-3944802 GGCCATGAGGGTAAAAGTTAGGG - Intergenic
1063224711 10:4004917-4004939 CTCTGTGAGGTCCAAAGTTTAGG + Intergenic
1067698265 10:48550989-48551011 GTCCGTGAGGGCCACAGTGCTGG - Intronic
1071693387 10:87846378-87846400 CTGCTTCAGGGCCAAAGTTTGGG + Intergenic
1073247827 10:102104218-102104240 GTCCAGGAGGGACAGAGGTTTGG + Intergenic
1073703649 10:105958228-105958250 CTCCCAGTGGGCCAAAGTTTTGG - Intergenic
1082868533 11:57921210-57921232 GTCCAAGAGGGCCAATCCTTGGG - Intergenic
1083231789 11:61326210-61326232 GTCCATGATTGACAAAGTCTGGG - Intronic
1084452112 11:69245334-69245356 TTCCATCAGAGCCAGAGTTTGGG + Intergenic
1090023551 11:123148695-123148717 GGACATGAGGGCAGAAGTTTAGG - Intronic
1090253874 11:125269567-125269589 GTCCAAGAGGGCCTCAGTCTAGG - Intronic
1091289873 11:134433142-134433164 GTCAACGAGAGCCAAAGTTTAGG - Intergenic
1097177867 12:57153644-57153666 ATCCATGGGGGCAAAAGGTTGGG - Intronic
1098049346 12:66437088-66437110 GTCTCTGAGGTCCAAAGGTTTGG + Intronic
1099263711 12:80417276-80417298 GTCCATGATGGGGAAAATTTTGG - Intronic
1099622927 12:85026777-85026799 GGCCATGAGTGCCAAAGGTAGGG - Intronic
1109224490 13:59675778-59675800 AACCATGAGGGCCAACGATTTGG - Intronic
1109799429 13:67357356-67357378 GTTCATGAAAGGCAAAGTTTGGG - Intergenic
1111395828 13:87669343-87669365 GTTCATGTGGGTAAAAGTTTTGG + Intergenic
1111911966 13:94322882-94322904 GCCCATCAGGTCCAGAGTTTTGG - Intronic
1116845986 14:49865517-49865539 GGCCAAGAGGGCCAAAGTAGAGG - Intergenic
1117118471 14:52541271-52541293 GTCCATAAGGGCAACAGCTTGGG + Intronic
1122823694 14:104359561-104359583 GTCCATCTGGGCCAGAGGTTGGG + Intergenic
1125887268 15:43238212-43238234 GTCCATGAGGGCCAGAGGCAGGG - Intronic
1126996634 15:54452222-54452244 GTCCAGGAGGGCCAATTCTTGGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129591118 15:76916100-76916122 GTCCATGAGGTCCATAGATGTGG + Intergenic
1132878923 16:2152744-2152766 GACCTGGAGGGCCAAAGTTCTGG + Intronic
1138525915 16:57607185-57607207 GTCCCTGAGGGTCAAAGTCTAGG - Intergenic
1148548179 17:48532522-48532544 GTCCAGGAGGGCAAGAGTTCAGG + Intergenic
1151784131 17:76266697-76266719 GGCCAGGAGGGCAAAAGCTTGGG - Intronic
1157565050 18:48674287-48674309 GTCCCTGAAGGGCAAAGTCTGGG + Intronic
1158720453 18:59919893-59919915 GGCCCTGAGGGCCAAAGCCTGGG + Intergenic
1161983553 19:7642616-7642638 GCTCATGAGGGCCAAAGACTTGG - Intronic
1163177821 19:15576795-15576817 GTCAATGAAGTCCAAAGTCTTGG - Intergenic
1166155761 19:40909966-40909988 ATCCATGAGATCCAAAGATTTGG - Intergenic
1167413865 19:49360541-49360563 GGCCATGAAGGCTAAAGGTTCGG + Intronic
1167722584 19:51188484-51188506 CTCCAGGAGGGCCAGAGTTAGGG + Intergenic
1168327099 19:55544073-55544095 GGCCACGAGGGACAAAGGTTGGG - Intronic
925757639 2:7149017-7149039 GAACATGAGGGCCAACGTTCTGG + Intergenic
925865269 2:8221442-8221464 GTCCAGGAGGGGCACAGTGTGGG - Intergenic
926019907 2:9485688-9485710 GTCCATGGTGGCCAGAGGTTAGG + Intronic
926750446 2:16194883-16194905 TTCTTTGAAGGCCAAAGTTTTGG + Intergenic
926964731 2:18397347-18397369 CTCCATGAGGGCAGAGGTTTTGG + Intergenic
928792404 2:34973559-34973581 CTTCATAAGGCCCAAAGTTTGGG - Intergenic
929377280 2:41303268-41303290 GGCTATAAGGTCCAAAGTTTGGG + Intergenic
933469215 2:82699755-82699777 CTCCATGAGGGTAAAAGATTTGG - Intergenic
937007213 2:118528026-118528048 TTCCATGACAGCCAAAGTTGAGG - Intergenic
945920527 2:215750530-215750552 TTCCATGAGGGCCCAGGATTAGG + Intergenic
946685576 2:222266245-222266267 GTGCAAGAGTCCCAAAGTTTAGG + Intronic
948047241 2:234953400-234953422 GTCTCTGAGCTCCAAAGTTTGGG + Intronic
1173180044 20:40799399-40799421 GTCCATGAAGTCCAAAATGTTGG + Intergenic
1176388560 21:6151766-6151788 GTCCCTGAGGGTCAACGTTTGGG - Intergenic
1177769043 21:25494034-25494056 GTCCATGAGTGCCCAAAGTTCGG - Intergenic
1179122510 21:38560796-38560818 CTCCATGAGGACCACAATTTGGG - Intronic
1179734912 21:43386482-43386504 GTCCCTGAGGGTCAACGTTTGGG + Intergenic
1181770111 22:25119074-25119096 GTCCATGAGGGCCAGGGCTTTGG + Intronic
950590389 3:13932604-13932626 CTCCATGAGGGCAATAATTTGGG + Intergenic
950624924 3:14238284-14238306 GTCCATGATGCCCAAAATGTTGG - Intergenic
960802967 3:121557458-121557480 CTCCAAGAGAGTCAAAGTTTAGG - Intergenic
963346226 3:144099151-144099173 GCTCATCAGTGCCAAAGTTTTGG - Intergenic
964682799 3:159361076-159361098 GTCCATGAGGACAAGAATTTTGG - Intronic
972256674 4:37363577-37363599 GTCCATGAGTACCCAATTTTTGG - Intronic
974577578 4:63747723-63747745 CTCCCTGAGGGACAAGGTTTTGG - Intergenic
977066643 4:92325203-92325225 GTCCATAAGTGCTAAAATTTGGG - Intronic
980222272 4:129934185-129934207 GTCTATTACGCCCAAAGTTTAGG + Intergenic
980717988 4:136653169-136653191 GTCCTGGAGTGACAAAGTTTAGG + Intergenic
985575967 5:673653-673675 GACCATGAGGGTCAAGGTCTGGG - Intronic
986724661 5:10585358-10585380 GTCCATCAAGGACAATGTTTAGG - Intronic
987561959 5:19535841-19535863 TTCCAAAAGAGCCAAAGTTTGGG - Intronic
997053579 5:130412949-130412971 TTCCATGAGGTAGAAAGTTTTGG - Intergenic
998980017 5:147691625-147691647 ATCCTTCAGGGCCAAAGCTTGGG - Intronic
1001952208 5:175824117-175824139 GTCCTTGAGGGTGAAAGGTTGGG - Intronic
1005988408 6:30888835-30888857 GTCCCTGAGGGCCAGGGCTTGGG + Intronic
1011670112 6:89675125-89675147 GTCCATGTGGGCCAATAGTTAGG - Intronic
1014724326 6:124956460-124956482 GTGCATGAGGGCCTGAGTATTGG + Intergenic
1018879543 6:167862866-167862888 GTAAAGGAGGGCCATAGTTTTGG - Intronic
1028979293 7:96949518-96949540 GACAGTAAGGGCCAAAGTTTGGG + Intergenic
1028981520 7:96972388-96972410 ATCCATGAGGGACATGGTTTGGG - Intergenic
1030551264 7:110963394-110963416 GTCCATGAGGGCCAAAGTTTTGG - Intronic
1030920945 7:115386422-115386444 GTCTATGCGGGCAAGAGTTTGGG - Intergenic
1034538776 7:151742873-151742895 TTACATGAGGGACAAAGCTTTGG + Intronic
1034635606 7:152565100-152565122 GTACATGAGGGAGAAAGTGTAGG + Intergenic
1038340656 8:26682691-26682713 TTACATGAGGGCCAAAGATCTGG - Intergenic
1041627247 8:60044649-60044671 GACCATGAGGGCAATAGGTTGGG - Intergenic
1041949010 8:63479220-63479242 GTCCATGAAGTACATAGTTTGGG - Intergenic
1043938084 8:86166011-86166033 GTCTATGAGGGACAAACCTTAGG + Intergenic
1047759906 8:127946711-127946733 GTGCACAGGGGCCAAAGTTTGGG + Intergenic
1049933331 9:476673-476695 GTCCATCATGGCCAAAATCTTGG - Intronic
1050009535 9:1171916-1171938 GATGATGAGGGCCAGAGTTTGGG - Intergenic
1051730218 9:20134021-20134043 GACCATGGAGGACAAAGTTTAGG + Intergenic
1052108951 9:24555599-24555621 TCCTATGAGGGCAAAAGTTTGGG + Intergenic
1059104215 9:111497734-111497756 GTTCATCTGGGCCAAGGTTTAGG - Intergenic
1060084841 9:120688531-120688553 GTCCATGAGGGCGTTAATTTTGG - Intronic
1060164224 9:121395835-121395857 CTCCAAGAGGGCAGAAGTTTTGG - Intergenic
1060884921 9:127144273-127144295 GTCCATGAGGGCCACCGCTGGGG - Intronic
1187050982 X:15695390-15695412 GTCCCTGTGGGCCAAGGCTTAGG + Intronic
1189200427 X:39190908-39190930 CTCCATGAGGGCAAGTGTTTCGG + Intergenic