ID: 1030553916

View in Genome Browser
Species Human (GRCh38)
Location 7:110999348-110999370
Sequence CTGGATTGTACCTCTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030553914_1030553916 0 Left 1030553914 7:110999325-110999347 CCATGGTTTTTTTTTTTGAGATT 0: 1
1: 0
2: 37
3: 1142
4: 4821
Right 1030553916 7:110999348-110999370 CTGGATTGTACCTCTTTTATTGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030553916 Original CRISPR CTGGATTGTACCTCTTTTAT TGG Intronic
903025347 1:20426136-20426158 CTGAATTGTACCTGTTAAATGGG + Intergenic
905508537 1:38500136-38500158 CTGGATTTTCCTTCTTTTACAGG + Intergenic
906651411 1:47515591-47515613 CTGGAGTGTACCGCTATTCTAGG - Intergenic
910808035 1:91208090-91208112 CTGCATGGTAGCTCTTTTCTAGG - Intergenic
911493646 1:98602020-98602042 CTGGATTTTATTTCTTTTAAAGG - Intergenic
911953902 1:104211502-104211524 CTGGTTTTTACATCTTTTATTGG + Intergenic
912657402 1:111499406-111499428 CTGGAGTGTAGCTCTTTGCTGGG - Intronic
913410034 1:118541655-118541677 CTGGATTCAACCTCTTTCCTAGG - Intergenic
917158822 1:172034190-172034212 CTGTATTGTACCTCTTAAAATGG - Intronic
918320862 1:183363316-183363338 ATGGATTGTATCTCTCTTATAGG + Intronic
920808615 1:209259506-209259528 CTGAATTGCACCTGTTTTAATGG - Intergenic
922248927 1:223828938-223828960 CTGAATTGTACATTTTATATGGG + Intronic
924487238 1:244497383-244497405 TTGGATTGTTTCTCTTTTAATGG - Intronic
1065306242 10:24371790-24371812 CTGGATTCTAAATGTTTTATGGG + Intronic
1066334266 10:34460534-34460556 CGGCCTTGTACCTATTTTATTGG - Intronic
1070184651 10:74049434-74049456 CTGTATTATAGCTCTTTAATTGG - Intronic
1072939939 10:99753272-99753294 CAGTATTATCCCTCTTTTATTGG + Intronic
1080174307 11:29343508-29343530 CGTGGTTGTTCCTCTTTTATTGG - Intergenic
1080362290 11:31529807-31529829 CTAGATTCTACCTCTTTGAGGGG + Intronic
1082217464 11:49590396-49590418 TTGGAATGTACCTTTTTTAAAGG + Intergenic
1083343505 11:61973943-61973965 CTGGATTGTGCCCCTTCTCTGGG - Intergenic
1086521734 11:87676083-87676105 CTGGTTTGTACTTCTCTTACGGG + Intergenic
1090862509 11:130666556-130666578 CTGCATTGTACCTAATTTGTTGG - Intergenic
1093097614 12:14989781-14989803 CTGGATTCAGCCTCTTTTCTAGG - Intergenic
1093357386 12:18183379-18183401 CTGCATTTTACCTCTTGTGTGGG - Intronic
1093530692 12:20158922-20158944 TTTGTTTGTAACTCTTTTATTGG + Intergenic
1093794832 12:23298885-23298907 ATGGATTCTACATCTTGTATAGG + Intergenic
1096275741 12:50206472-50206494 CTGCATTATACCTCTTTAACTGG + Intronic
1097447170 12:59685803-59685825 CTAAATTGTACCAGTTTTATAGG + Intronic
1097508113 12:60502084-60502106 CTACACTATACCTCTTTTATTGG - Intergenic
1097582914 12:61480798-61480820 CTGGATTTAACCTCTTTCCTAGG - Intergenic
1097637692 12:62142834-62142856 CTGGATTGTAACTATTTGCTGGG + Intronic
1100725082 12:97399960-97399982 ATTGATCTTACCTCTTTTATGGG - Intergenic
1107581421 13:41792317-41792339 CTGGATTTTACCTTTTGTGTGGG + Intronic
1109671877 13:65619621-65619643 TTGGATTGTCTCTCTTTTCTTGG - Intergenic
1110760318 13:79223845-79223867 TTGAATTTTACCTCTTTAATGGG - Intergenic
1111151612 13:84261161-84261183 CTGTATTGCATCTCTCTTATGGG + Intergenic
1111922514 13:94427243-94427265 CTTGATTATACTTCTTTTATGGG - Intergenic
1111944245 13:94647003-94647025 CTGGAGTGGACCTGTTTTATTGG + Intergenic
1112977762 13:105341956-105341978 GGCAATTGTACCTCTTTTATCGG + Intergenic
1112979198 13:105360497-105360519 CTGTATTGTAACTCTTTAAATGG - Intergenic
1115634280 14:35276339-35276361 CAGGGGTGTACCTCTTTTAAGGG + Intronic
1116261034 14:42626770-42626792 CTGGTTTCTTCCTCTTTAATTGG - Intergenic
1119627907 14:76197647-76197669 TCGGATTCCACCTCTTTTATAGG + Intronic
1120389436 14:83887388-83887410 GTGGTTTGTAGCTCTTTCATTGG - Intergenic
1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG + Intronic
1126745214 15:51819002-51819024 CTGGTTTACACCTGTTTTATTGG + Intergenic
1126749119 15:51858474-51858496 CTGGTGTATACCTGTTTTATTGG - Intronic
1131975761 15:97944176-97944198 CTGGCTTGTACCTCTTGTAAAGG - Intergenic
1134370865 16:13623145-13623167 CTGGAGTATTCTTCTTTTATAGG - Intergenic
1138622065 16:58219375-58219397 CTGGATAGCACACCTTTTATTGG - Intergenic
1140082986 16:71768090-71768112 ATGCATTGAACTTCTTTTATAGG - Intronic
1140802207 16:78498898-78498920 CTCGATTGTCTCTCCTTTATTGG + Intronic
1149388381 17:56165048-56165070 CTGGAGTGAACCTATTTTACAGG - Intronic
1153542810 18:6174064-6174086 CTTGATTTTACCCCTTTTTTAGG - Intronic
1155591229 18:27429238-27429260 CTGGATGGTACCTCATTTCCTGG + Intergenic
1156976621 18:43229683-43229705 CTGGATTCTACCTTTGTTAGTGG + Intergenic
1160159497 18:76460432-76460454 TTAGATTGTACCCCTTTTATTGG - Intronic
1164190396 19:22911233-22911255 CTGTATTGTATTTCTTTTACTGG - Intergenic
925643788 2:6013703-6013725 TTGGATTGTTTCTCTTTTTTTGG + Intergenic
926193816 2:10748590-10748612 ATGGTTTGTCCATCTTTTATGGG + Intronic
927328082 2:21829669-21829691 CTGGATTGTCTCTCTTTTCTTGG + Intergenic
930508119 2:52310404-52310426 CTGGATGGTACCAATTTTCTGGG - Intergenic
931316113 2:61133904-61133926 CTGGATTGTACCATTTAAATGGG + Intronic
931705766 2:64944929-64944951 CTTCATTGTACCTTTTTTCTTGG - Intergenic
931809971 2:65845350-65845372 CTGGAATGTATCCATTTTATAGG + Intergenic
932945990 2:76232029-76232051 CTGGATTGTACTTTTTAAATGGG - Intergenic
936803628 2:116297568-116297590 ATGAATTGGAGCTCTTTTATAGG - Intergenic
938653685 2:133409370-133409392 CAGGATTGTACCCTTTTTGTAGG + Intronic
939351902 2:141049191-141049213 ATGAGTTGTTCCTCTTTTATGGG - Exonic
939932181 2:148249356-148249378 GTGGATTTTGCCCCTTTTATGGG - Intronic
943165681 2:184322240-184322262 CTGCATTATATCTCTTTTAGGGG + Intergenic
943897526 2:193384258-193384280 CCGATTGGTACCTCTTTTATGGG - Intergenic
944749386 2:202692976-202692998 CTGGCTTGTACATTTTTTAATGG - Intronic
945105162 2:206304865-206304887 CTGGAATGTAACTCTTCAATAGG - Exonic
945835229 2:214831826-214831848 GTGTCTTGTCCCTCTTTTATAGG - Intergenic
946203528 2:218086468-218086490 TTGGATTCTACTTCTTTTATAGG - Intronic
1171124453 20:22589335-22589357 ATGGATTGTCCATCTTTTATGGG + Intergenic
1182604712 22:31494246-31494268 CTGGATTGCACCTCTCTAAATGG + Intronic
953932963 3:47015603-47015625 GTGCACTATACCTCTTTTATAGG + Intergenic
956060951 3:65347533-65347555 CTAGACAGTATCTCTTTTATTGG - Intergenic
956961797 3:74411463-74411485 CTGGATTATTCCTCTTTGATAGG + Intronic
956996054 3:74827578-74827600 CTGCATGGTAGCTCTTTTCTAGG + Intergenic
957264790 3:77949214-77949236 ATGGAGAGTACATCTTTTATGGG - Intergenic
962762480 3:138527895-138527917 CTGGATTATAACTGTTTCATAGG + Intronic
963378719 3:144503144-144503166 CTGGATAGTACCTATTTCATTGG - Intergenic
965289505 3:166861263-166861285 CTGGATTTTAACTCTTATGTAGG - Intergenic
965850296 3:173014792-173014814 CTGGTTTGTACCTGTTTTCCTGG + Intronic
967558946 3:190895585-190895607 CTGCATTGTGCCTCTGTTCTAGG + Intergenic
969952721 4:10854410-10854432 CTGGATTCCACCTCCTTTCTAGG + Intergenic
970403392 4:15739375-15739397 CTGCATTCTACATCTTTTAGGGG - Intergenic
972054566 4:34782637-34782659 TTGGATTATAGCTCTTTTTTTGG + Intergenic
972420960 4:38885790-38885812 CTGGACTGTGCATATTTTATTGG + Intronic
973317179 4:48774220-48774242 CTGAATTGTACATTTTTAATAGG + Intronic
973723507 4:53749399-53749421 ATGGATTGTGCCTGTTTTAACGG + Intronic
973990740 4:56404287-56404309 CTGTAGTGTACTACTTTTATAGG - Intronic
974891549 4:67890208-67890230 CTTGACTGTATCTCTTTTCTTGG + Intergenic
976030882 4:80751880-80751902 CTGGATTCAACCCCTTTTCTAGG + Intronic
977966099 4:103150183-103150205 ATTGATTTTACCTTTTTTATAGG + Intronic
977970782 4:103211568-103211590 CTGGATTGACCCTCCTTTAGTGG + Intergenic
977972419 4:103227678-103227700 CTGCATGGTAGCTCTTTTCTAGG + Intergenic
980520265 4:133922488-133922510 CTATATTTTACTTCTTTTATAGG + Intergenic
982585719 4:157235331-157235353 CTGTATTGAACATTTTTTATGGG + Intronic
983052346 4:163063062-163063084 CTGGACTGTACCACATTTGTAGG - Intergenic
984763554 4:183382933-183382955 CTGTGTTGTACATTTTTTATTGG - Intergenic
986112691 5:4735563-4735585 CTGGATGGATCCTGTTTTATGGG + Intergenic
987895085 5:23934213-23934235 CTGTATTTTACCTCACTTATTGG - Intergenic
988944542 5:36183162-36183184 CTGGATTTTAACTCTTATGTAGG - Exonic
990845613 5:60135144-60135166 CTCTCTTGGACCTCTTTTATAGG - Intronic
994303430 5:98174125-98174147 CTTGATAGTACATCTTTTATTGG - Intergenic
994504303 5:100621854-100621876 CTGGAGGGAACCTCTTCTATCGG - Intergenic
1000031487 5:157406007-157406029 CTGGATTCTGCCTCTTTCCTAGG - Intronic
1000119197 5:158180488-158180510 CTGGATGATGCCTGTTTTATGGG - Intergenic
1000230947 5:159314536-159314558 CTGCATTGTGCCTTTTTTAGGGG - Intergenic
1001725654 5:173896168-173896190 CTGTATTGTACCTCAGTTTTTGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007041257 6:38724584-38724606 CTGGATTATACCTATTTTCCTGG + Intronic
1016964416 6:149705459-149705481 CTGGATTGCAATTCATTTATAGG + Intronic
1018827303 6:167418642-167418664 CTGGATTAAACTTCTCTTATTGG - Intergenic
1020769475 7:12370067-12370089 GTCGATTGTACCTCATTTCTTGG + Exonic
1021131610 7:16919206-16919228 CTGAATTGTACATTTTTTAATGG - Intergenic
1022284494 7:28942117-28942139 CTGGACTGTGCCTCTTTTTCTGG + Intergenic
1022744044 7:33151519-33151541 CAGGATTATACCTCTCTCATAGG + Intronic
1030170967 7:106602455-106602477 CTGAGTTGGACCTCTTTTTTGGG + Intergenic
1030263702 7:107594081-107594103 CTGGATTTTCCCTATTTTTTTGG + Exonic
1030553916 7:110999348-110999370 CTGGATTGTACCTCTTTTATTGG + Intronic
1031406576 7:121394572-121394594 CTGGACTGAACTCCTTTTATTGG + Intronic
1037575922 8:20202712-20202734 CAAGATTGTATCTCCTTTATAGG - Intronic
1044819643 8:96146995-96147017 CTGGGTTGTAAATATTTTATGGG - Intronic
1045655359 8:104381484-104381506 CTGGATTGTCCCACTTTTTGTGG + Intronic
1046250743 8:111627571-111627593 CTGATTTGTACCTTTTTTTTTGG + Intergenic
1050942585 9:11478714-11478736 CTGTATTGTAACTCCTTTAGTGG + Intergenic
1051899956 9:22026636-22026658 CTGGATTCAGCCTCTTTTCTGGG + Intronic
1052362860 9:27578407-27578429 CTGCATTGTTCCTCTGTTCTAGG - Intergenic
1052453024 9:28656294-28656316 CTGTATTTTTCCTTTTTTATAGG - Intronic
1058880551 9:109282362-109282384 CTGGATTGTACATTTTGGATAGG + Intronic
1060681144 9:125566224-125566246 CTGGACTGTGTCTGTTTTATGGG - Intronic
1186451787 X:9680094-9680116 CTTGCTTGAGCCTCTTTTATAGG + Intronic
1186729243 X:12391016-12391038 TTGGATTGTACATCTTTTAAAGG - Intronic
1187597557 X:20790394-20790416 CTGGATGTGCCCTCTTTTATTGG + Intergenic
1192796496 X:74428019-74428041 CTGGATTGTACCTCTTGAACTGG + Intronic
1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG + Exonic
1194482677 X:94446241-94446263 GGGCATTGCACCTCTTTTATTGG - Intergenic
1197705222 X:129630055-129630077 CTGGATGGAAACTCTTTTACTGG - Intergenic
1198648792 X:138838238-138838260 CTGGATTCAGCCTCTTTTCTAGG + Intronic
1201260040 Y:12149956-12149978 CTGCATTGTAGCTCTTTTCCAGG - Intergenic