ID: 1030556713

View in Genome Browser
Species Human (GRCh38)
Location 7:111034155-111034177
Sequence AAGTAGTTACAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 1, 2: 3, 3: 90, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030556713 Original CRISPR AAGTAGTTACAAAATGAGGA GGG Intronic
900209668 1:1448179-1448201 AAGTACTTACAGAACCAGGAAGG - Intergenic
900219656 1:1500999-1501021 AAGTACTTACAGAACCAGGAAGG - Intergenic
901588920 1:10322710-10322732 AAATAATTATAAAATGAGAAAGG - Intronic
901687958 1:10954750-10954772 AAAAAATTACAAAATGAGGTGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902832293 1:19024159-19024181 AAGTAGTCAGAAAATCAGAAAGG + Intergenic
904571268 1:31467551-31467573 AAGTACTTACAGAACCAGGAAGG - Intergenic
905567758 1:38979408-38979430 AAGTACTTACAGAATTAGGAAGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905908376 1:41636239-41636261 AAATGGGTACAGAATGAGGAAGG + Intronic
906507552 1:46391446-46391468 AAGCACTTACAGAATCAGGAAGG - Intergenic
906767052 1:48443143-48443165 AAGTACTTACAGAATCAGGAGGG + Intronic
906885678 1:49644708-49644730 AACTAGATAGAAAATCAGGAAGG + Intronic
907464614 1:54626791-54626813 CAGCAGTTCCAAAATGAGAATGG - Intronic
907772356 1:57478212-57478234 CAGTAGTTACAGAATTAGAAAGG + Intronic
908180492 1:61599366-61599388 AAGTAGTAACCAAAAGAGCAGGG + Intergenic
908300910 1:62760353-62760375 AAGTACTTACAGAATCAGGAAGG + Intergenic
908500426 1:64738165-64738187 TGGTAGTTAAAAAATGAGGCTGG - Intergenic
909534173 1:76717211-76717233 AACTATTTCCAAAAAGAGGAAGG + Intergenic
909689127 1:78386749-78386771 AAGTATTTGCTAAATGATGAAGG - Intronic
910396950 1:86803094-86803116 AAGTACTTACAGAATCAGGAAGG - Intergenic
911143991 1:94535073-94535095 AAGTAGATACCAGAGGAGGATGG + Intronic
911299216 1:96152221-96152243 AAGTACTTATAGAATCAGGAAGG + Intergenic
911356914 1:96834004-96834026 ATGTATTTACAAAAAAAGGAAGG - Intergenic
911475710 1:98369650-98369672 ACACAGTTATAAAATGAGGAGGG + Intergenic
911528983 1:99021086-99021108 AAGTATTTACATAAAGATGAGGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911751882 1:101504912-101504934 AAGTACTTACAGAACCAGGAAGG + Intergenic
911975456 1:104488995-104489017 AAATGGTTACAAAAAGAGCAAGG - Intergenic
912324221 1:108742667-108742689 AAGTAATTACAATATGAGTGGGG - Exonic
912633019 1:111264788-111264810 AAGTTGTTACATAATGATAAAGG - Intergenic
913713743 1:121512855-121512877 TAGTACTTACAGAATCAGGAAGG + Intergenic
913978248 1:143483136-143483158 TAATAGTTACAAAATAAGCAAGG + Intergenic
914072655 1:144308781-144308803 TAATAGTTACAAAATAAGCAAGG + Intergenic
914106499 1:144657575-144657597 TAATAGTTACAAAATAAGCAAGG - Intergenic
914242517 1:145861285-145861307 CAGTAGTTGCAGGATGAGGAAGG + Intergenic
914460797 1:147882823-147882845 AAGTAGATAAAAAATCAGTAAGG - Intergenic
915453721 1:156024913-156024935 AATGAGTTAAAAAATGAGGCGGG - Intergenic
915697277 1:157756517-157756539 AAGTAATTAAAAAATTAGCAAGG + Intronic
915916254 1:159942643-159942665 AAGCAGTTACAGAATTAGAATGG + Intronic
916084162 1:161256432-161256454 AAGTACTTACGGAATCAGGAAGG + Intergenic
916367527 1:164048634-164048656 AAGTATTGACAAAATGAATACGG - Intergenic
916511439 1:165475305-165475327 CAGTGATTACAAAATGAGGTGGG - Intergenic
916892228 1:169123035-169123057 AAGTGGTTACATAATGAGGTGGG - Intronic
917015337 1:170525119-170525141 AAGGAGTCAGAAAATGAGTAAGG + Intergenic
917227820 1:172802708-172802730 AAGTACTTACAGAATCAGGAAGG + Intergenic
917246669 1:173010301-173010323 GAGAAGTTACAAAATCAGGAAGG - Intergenic
917676609 1:177324633-177324655 AAGTACTTACAGAATCAGGAAGG + Intergenic
918189778 1:182163073-182163095 AAATATTTACAAAATGTGAAGGG + Intergenic
918284054 1:183034731-183034753 AAGTAGTTAGATAATGGTGAAGG + Intronic
918769156 1:188531294-188531316 AAGTAATTTCAAAAAGAGGTGGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919257277 1:195140771-195140793 AAGTACTTACAGTATCAGGAAGG + Intergenic
919423248 1:197398300-197398322 AAGTAAATAGAAAATGAGAAAGG - Intronic
919559197 1:199096531-199096553 AAGTACTTACAGTATCAGGAAGG + Intergenic
919655532 1:200193488-200193510 AAGTCATTAGAAAATAAGGAGGG - Intergenic
919683303 1:200457022-200457044 AAGTAGCTATCAAATGAGTAAGG - Intergenic
919719112 1:200812831-200812853 AAGAAGTCACAAAATGAGATAGG - Intronic
920246901 1:204594784-204594806 AAGTAGTCAGAAAATTAGCAAGG - Intergenic
921020180 1:211228046-211228068 AAGTACTTACAGAATCAGGAAGG + Intergenic
921990573 1:221361536-221361558 GAGTAGTGAAAAAATGAAGATGG + Intergenic
922248758 1:223827003-223827025 CACTAGGTACAAAGTGAGGAAGG + Intronic
922382553 1:225046902-225046924 AAGTAGTCACAAGACAAGGATGG - Intronic
923161682 1:231319842-231319864 AAGCAGTCAAAAAATGAGTAGGG - Intergenic
924908835 1:248486926-248486948 AAATAGTTACAAAATAAATAAGG - Intergenic
924915272 1:248561136-248561158 AAATAGTTACAAAATAAATAAGG + Intergenic
1063259148 10:4365242-4365264 AAATATTTACAAATTGAGAATGG + Intergenic
1063310666 10:4949081-4949103 AAGAAGTTACAAAAGCTGGAGGG + Intronic
1063912474 10:10845919-10845941 AAATAGTTACATAATAATGAGGG - Intergenic
1064011637 10:11741114-11741136 TAGTAGTTACAGAGTCAGGACGG - Intergenic
1064062972 10:12154816-12154838 AAGTGAGTACAAAATGAGGGTGG + Intronic
1064603061 10:17012716-17012738 AAGTACTTACAGAATCAGGAAGG - Intronic
1064615352 10:17148362-17148384 AAGTACATACAAAATGAAGAAGG + Exonic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1065038775 10:21668980-21669002 AAGTATTTGAAAAATGAGGTGGG + Intronic
1065082918 10:22144951-22144973 AAGTACTTACAGAATCAGGAAGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066157323 10:32691875-32691897 AAATAGTTCCCAACTGAGGAAGG + Intronic
1067813869 10:49456056-49456078 AGTTAGTTGCAAAATAAGGATGG + Exonic
1068240908 10:54299826-54299848 AAGTACTTACAGAATCAGGAAGG + Intronic
1069364722 10:67685294-67685316 AAGTACTTACAGAATCAGGAAGG - Intronic
1069967765 10:72135608-72135630 CAGTAGTTACAGAGTGAGGTGGG + Intronic
1069972548 10:72184700-72184722 AAGTAGATACAAAATCAGTATGG + Intronic
1071153493 10:82663497-82663519 AAGGAGTTAGCAAAGGAGGAAGG + Intronic
1071265734 10:83963194-83963216 AGGTAGTTAGATCATGAGGATGG + Intergenic
1071283265 10:84122440-84122462 AAGTACTTACAGAATCAGGAAGG - Intergenic
1071835231 10:89411414-89411436 AAATACTTACAGAATCAGGAAGG + Intronic
1074251563 10:111755894-111755916 AACTAGGTACAAAATGATTAGGG - Intergenic
1074613293 10:115041337-115041359 AAGTACTTACAGAATCAGGAAGG + Intergenic
1074849943 10:117431809-117431831 AAGCAGCTACTAAATGGGGAAGG + Intergenic
1074930210 10:118117243-118117265 AAGAAATTAGAAAAGGAGGAGGG - Intergenic
1075434345 10:122422279-122422301 AACTAGTTGCAAAATTATGATGG + Intronic
1077436943 11:2546498-2546520 AAGTAGATACAAAATCAGTAAGG - Intronic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1079237238 11:18699335-18699357 ACTTGTTTACAAAATGAGGAAGG - Intronic
1079811168 11:25001226-25001248 AAGTACTTACAGAATCAGGAAGG - Intronic
1081033684 11:38115715-38115737 AAGTACTTACAGAATAAGGAAGG + Intergenic
1081467053 11:43330257-43330279 ATGTAGCTAAAAAATGAGTAAGG - Intronic
1081710417 11:45212420-45212442 AAGTGGTTACAAAAGGGAGAAGG - Intronic
1085232831 11:74987971-74987993 AAGAACTCACAAAATGATGAGGG - Intergenic
1085869959 11:80337951-80337973 AGGTATTTACAAAATCAGGGAGG + Intergenic
1086317904 11:85612508-85612530 AAGTACTTACAGAATCAGGAAGG + Intronic
1086750412 11:90486724-90486746 AAATAATTTAAAAATGAGGAAGG - Intergenic
1086987307 11:93264274-93264296 AAGTACTTACAGAACCAGGAAGG + Intergenic
1087458752 11:98420768-98420790 AAGTACTTACAGAATCAGGGAGG - Intergenic
1087548199 11:99611674-99611696 AAGTAGTTGAAAAAGGTGGATGG + Intronic
1087640184 11:100748222-100748244 AAGTACTTATAGAATCAGGAAGG - Intronic
1087786328 11:102358704-102358726 AAGTAATTATATAATGAGAAAGG - Intronic
1093356595 12:18174670-18174692 AAGTACTTACAGAACCAGGAAGG + Intronic
1094087514 12:26609704-26609726 ATGTGGTTAGAAAATGAGAAGGG + Intronic
1094319500 12:29170096-29170118 AAGTACTTACAGAATCAGGAAGG - Intronic
1094384183 12:29876010-29876032 AACTAGTTATATAATAAGGAAGG + Intergenic
1097276444 12:57816755-57816777 TAGTAGTGACAAAAGAAGGAAGG - Intronic
1098739903 12:74160343-74160365 AAATAGTTAGAAAGTCAGGATGG - Intergenic
1098830608 12:75357456-75357478 AAGTAGATAGAAAATAAGTAGGG + Intronic
1099176045 12:79423474-79423496 AAGTACTTACAAAATTCTGAGGG - Intronic
1099293179 12:80797902-80797924 AAGTAATTATCAAATGAGGATGG + Intronic
1099466233 12:82991357-82991379 AATAAGTTATAAAAAGAGGATGG - Intronic
1099576607 12:84391291-84391313 AAGTACTTACAGAATCAGGAAGG - Intergenic
1100050636 12:90444866-90444888 AAGTACTTACAGAATAAGGAAGG - Intergenic
1100676221 12:96871041-96871063 GAGTAGTTAGAAATTAAGGAGGG + Intronic
1100822898 12:98448146-98448168 AAGCACTTAGACAATGAGGAGGG - Intergenic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1102542109 12:113628533-113628555 GAGTAGTCACAGAATGAGGTAGG + Intergenic
1102606181 12:114069183-114069205 AAGTACTTACAGAACCAGGAAGG + Intergenic
1103047760 12:117751863-117751885 AAGGAATTACCAAATGAGTATGG + Intronic
1103286946 12:119810401-119810423 AAGAAGTAACAAAATGTGGCTGG + Intronic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104473144 12:129047299-129047321 AAATGGTTACTAAATGGGGAAGG - Intergenic
1105221099 13:18328323-18328345 TAATAGTTACAAAATAAGCAAGG - Intergenic
1105955308 13:25276393-25276415 AAGTAGTTTAAAAGTGGGGAGGG + Intronic
1106151861 13:27112267-27112289 AAGTAGCTATGAAATGATGAAGG - Intronic
1106163211 13:27218790-27218812 AAGTACTTACAGAATCAGGAGGG + Intergenic
1106609245 13:31262815-31262837 AAGTAGAGATCAAATGAGGAAGG - Intronic
1106791122 13:33155542-33155564 AAGAAGATACAAAATCAGGGAGG - Intronic
1106828545 13:33552223-33552245 AACTAGATACAAAATTAGCAAGG + Intergenic
1107618654 13:42200847-42200869 AAAAAGGTACAAAATCAGGAAGG + Intronic
1108338211 13:49468394-49468416 AAGTAATGATAAAATGAGAAAGG - Intronic
1108515813 13:51201507-51201529 AAGTACTTACAGAATCAGGAAGG - Intergenic
1108818317 13:54316747-54316769 AAGTACTTACAGAATCAGGAAGG + Intergenic
1108822307 13:54368469-54368491 AATAAGTTAGAAAATGAAGAAGG + Intergenic
1109046583 13:57419942-57419964 AAGTAGTTACATAATTTGCAAGG - Intergenic
1109346491 13:61120445-61120467 AAATAGTAACAAAAAGAGCAGGG + Intergenic
1109618286 13:64865718-64865740 AAGCAGTTACAAATTGCTGATGG - Intergenic
1109933498 13:69247613-69247635 AGCTAATTACAAAATGTGGAGGG + Intergenic
1110898970 13:80796116-80796138 AAGTTGTTACACACTGAGGTTGG - Intergenic
1111138280 13:84080382-84080404 AATAACTTACAAAATCAGGATGG - Intergenic
1111336211 13:86827210-86827232 ATGTAGCTACAAAATAAGGTGGG + Intergenic
1111371370 13:87322258-87322280 AAAGTGTGACAAAATGAGGAGGG - Intergenic
1111400099 13:87722741-87722763 AATAACTTACAAAATGAGGAAGG - Intergenic
1113206961 13:107927857-107927879 AACTAGTAAGAAAATGAGGCTGG - Intergenic
1113838336 13:113344241-113344263 CAGAAGTTACCAACTGAGGAAGG + Intronic
1114073822 14:19139434-19139456 TAGTAATTTTAAAATGAGGATGG - Intergenic
1114088443 14:19260551-19260573 TAGTAATTTTAAAATGAGGATGG + Intergenic
1115174344 14:30545409-30545431 AAATAGTAACAAAAGGAGAATGG - Intergenic
1115206426 14:30910774-30910796 TAGTAGTTACAAAAAGAAGGAGG - Intronic
1115211123 14:30968046-30968068 AAGTACTTACAAAACTAGGAAGG + Intronic
1115285087 14:31706929-31706951 AAGTACTTACAGAATCAGGAAGG - Intronic
1116725723 14:48559370-48559392 AAGTACTTACAGAACCAGGAAGG + Intergenic
1116791554 14:49345279-49345301 AAGTACTTCCATAATGTGGAAGG + Intergenic
1116910913 14:50463432-50463454 AAATATTTACAAAAAGAGGCAGG - Intronic
1117079395 14:52136124-52136146 AAAAAGATACAAAATGAGGGGGG + Intergenic
1117248066 14:53906306-53906328 AAGCAGTTACACAAAGAGGTAGG - Intergenic
1118166521 14:63341606-63341628 ATCTAGTTACAAAAGGATGATGG + Intergenic
1118721804 14:68599824-68599846 AAGTGGTTCCGAAAGGAGGAAGG - Intronic
1118867231 14:69713006-69713028 AAGCAGTGACAAAAGGGGGAGGG + Exonic
1119069948 14:71572440-71572462 AGGCAGTTACTAAATGAAGAAGG + Intronic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1122382540 14:101319127-101319149 AAGTACTTACAGAACCAGGAAGG + Intergenic
1123687427 15:22808970-22808992 AAGTACTTACAAAATGAAATGGG - Intronic
1124703862 15:31943770-31943792 AACTAAGAACAAAATGAGGAAGG + Intergenic
1124713412 15:32033334-32033356 GAGTAGTTACATAATTAAGATGG - Intronic
1125690124 15:41589277-41589299 AAGTACTTACAGAACCAGGAAGG + Intergenic
1126257773 15:46648108-46648130 AAGAAGTGAGAAAATTAGGATGG - Intergenic
1126482994 15:49147779-49147801 ATGTAGTCACAAAACGAAGAGGG - Intronic
1126964041 15:54030886-54030908 AGGTAGTAATAAAATCAGGAGGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128876858 15:71208888-71208910 CAGTAGTTTTTAAATGAGGAGGG + Intronic
1129743837 15:78004245-78004267 AAGGAGTTAAAAGATGAGAAGGG + Intronic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130883196 15:88072536-88072558 AAGCAGTTAAAAAATAAAGAAGG - Intronic
1131747535 15:95465319-95465341 AAGTAGTTGAAAAAAGATGATGG - Intergenic
1131926130 15:97385875-97385897 AAGGAGCTACCAAATCAGGATGG + Intergenic
1132624411 16:883931-883953 AGGTAGATAGAAAATAAGGAAGG - Intronic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1134905186 16:17973754-17973776 AAATAATTACATCATGAGGATGG - Intergenic
1135339149 16:21631439-21631461 AAGTACTTACAGAATCAGGAAGG - Intronic
1136741923 16:32541237-32541259 AAGTTTTTCCAAAATGATGAAGG - Intergenic
1139175446 16:64681525-64681547 CAGTAGTTAAATACTGAGGAGGG + Intergenic
1140339443 16:74142343-74142365 AAGTAGTTACAACATGAAAATGG + Intergenic
1141793912 16:86256639-86256661 AAGTGGTATGAAAATGAGGAAGG - Intergenic
1203027680 16_KI270728v1_random:533997-534019 AAGTTTTTCCAAAATGATGAAGG + Intergenic
1203044041 16_KI270728v1_random:800434-800456 AAGTTTTTCCAAAATGATGAAGG - Intergenic
1146292067 17:31615526-31615548 AAGTAGTTAAAATATGAGCAAGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148746518 17:49921192-49921214 AAGAAGGTACAAATTCAGGAGGG + Intergenic
1149014107 17:51888218-51888240 AGGAAGTAACAAAAGGAGGAAGG + Intronic
1149188351 17:54029085-54029107 AAGCAGTTACAATATCAGAAAGG - Intergenic
1149402525 17:56312829-56312851 AAGTAGTTACAAACTATGGTTGG + Intronic
1152601920 17:81267333-81267355 AAGTACTAAAAAAATGAGGGAGG + Intronic
1154149055 18:11891576-11891598 AACTAGTTACAAAATGAGGTTGG - Intronic
1155233583 18:23797234-23797256 AGGTAGTTACAAGACAAGGAAGG - Intronic
1155503480 18:26510385-26510407 AAGTTGTTTCAAAATGACCAGGG + Intronic
1155835678 18:30580994-30581016 AAGTGGTTGGGAAATGAGGAGGG + Intergenic
1156443675 18:37218154-37218176 AAATGGTTACAAAAAGAGCAAGG + Intronic
1156737348 18:40276427-40276449 AAGTAATGTCAAAATGAGTATGG + Intergenic
1156781749 18:40858297-40858319 AAGTAGTTAAGAAATGAGTTTGG + Intergenic
1156931029 18:42643656-42643678 AAGAAGGTACACACTGAGGAGGG - Intergenic
1157212229 18:45753455-45753477 AACTAGTTACATAAGGAGAAAGG - Intergenic
1158224264 18:55184317-55184339 AAGTAGTAACTTAATTAGGATGG + Intergenic
1158429095 18:57367671-57367693 AAGTACTTGCAAAAAGAAGAGGG + Exonic
1158975022 18:62703375-62703397 AATAAGTTAAAAAATGAGTATGG - Intergenic
1159051690 18:63426427-63426449 AGGTAGTGACAGAATGAAGAGGG - Intergenic
1159808759 18:72990394-72990416 AAGTAATTACAAAATGGGTCTGG - Intergenic
1159936762 18:74375100-74375122 AAGTAGATAAAAAATCAGTAAGG - Intergenic
1161597717 19:5159794-5159816 AAGTACTTACAGAATCAGGAAGG - Intronic
1161982111 19:7635390-7635412 AAGCTGTTACAAAAGGAGGAAGG + Intronic
1163095979 19:15057383-15057405 AAGTTGTTTCAAAATCAGGCTGG - Exonic
1163659755 19:18569618-18569640 AAGGAATTATGAAATGAGGATGG - Intergenic
1163927309 19:20358125-20358147 AAGTTGTTACAAAAAGAGCTAGG + Intergenic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164992537 19:32694785-32694807 AAGTACTTACAGAATCAGGAAGG - Intronic
1165961999 19:39542688-39542710 AAGAAGCTACAAATAGAGGAAGG + Intergenic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
925704385 2:6669989-6670011 AAGTTGTTAAAAAATAAGGTGGG + Intergenic
925831672 2:7902567-7902589 CAGTATTTACAAACTGAGAAGGG - Intergenic
925949379 2:8896668-8896690 AAGTACTTATAGAATCAGGAAGG - Intronic
926503221 2:13680011-13680033 AAGTACTTACAGAACCAGGAAGG + Intergenic
926995185 2:18727643-18727665 AATTAGTTTCTAAATGAAGATGG + Intergenic
927126677 2:20018652-20018674 AAATAATTACAAAGTGAGTAAGG - Intergenic
927271837 2:21218963-21218985 AAGTGGATACAAAATCACGAAGG - Intergenic
927397850 2:22674855-22674877 ACATAGTTAGTAAATGAGGAAGG - Intergenic
928006554 2:27567567-27567589 AAGCAGTTACAACCTGGGGATGG + Intergenic
928347975 2:30518454-30518476 AAGTACTTACAGAACCAGGAAGG + Intronic
929743401 2:44629064-44629086 AAGTAGACATAAAATGAGTAAGG - Intronic
930144833 2:47991398-47991420 AATTACTTACAAAATAAGGCAGG + Intergenic
931100627 2:58996550-58996572 AAGTGGCCACAAACTGAGGAAGG + Intergenic
931540822 2:63327265-63327287 AAGTACTTACAGAATCAGGAAGG + Intronic
932947432 2:76252538-76252560 AAATATTTACAAAATGGGGAAGG - Intergenic
933342400 2:81039461-81039483 AAGTACCTACAGAATCAGGAAGG + Intergenic
933389669 2:81653827-81653849 AAGTACTTACAGAACCAGGAAGG - Intergenic
934182957 2:89644144-89644166 TAATAGTTACAAAATAAGCAAGG + Intergenic
934293245 2:91718331-91718353 TAATAGTTACAAAATAAGCAAGG + Intergenic
934933464 2:98446674-98446696 AAGTAGCTACATGATGAGTAAGG - Intronic
935247908 2:101235271-101235293 AAGTATTTACAGAATCATGAAGG + Intronic
937040622 2:118817863-118817885 AAGTAGTTCCAGAATGAAAACGG + Intergenic
937411496 2:121680767-121680789 AAGTACTTACAGAACCAGGAAGG - Intergenic
938487756 2:131730804-131730826 TAGTAATTTTAAAATGAGGATGG - Intronic
938805699 2:134805433-134805455 ACGTACTTACAGAATCAGGAAGG - Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
941243770 2:163071938-163071960 AAGTACTTACAGAATCAAGAAGG + Intergenic
941980707 2:171453461-171453483 ATGAAATTACAAAATGAGTAAGG + Intronic
942101895 2:172591848-172591870 AAGTACTTACAGAATCAGGAAGG - Intronic
942858700 2:180584006-180584028 AACAAGTTACATAATCAGGAGGG + Intergenic
943102818 2:183508688-183508710 AAGTACTTACAGAATCAGCAAGG - Intergenic
943196182 2:184753240-184753262 ATGTATTTACAAAATGAGGCTGG + Intronic
943369439 2:186999950-186999972 AAGTAGATAGAAAATCAGTAAGG - Intergenic
943773891 2:191744180-191744202 AAGTAGTTTAAAAATGATAATGG - Intergenic
943902264 2:193455414-193455436 AAGTACTTACAGAATCAGGAAGG + Intergenic
944476266 2:200110095-200110117 ATTCTGTTACAAAATGAGGAGGG - Intergenic
944788953 2:203104281-203104303 AAGAAGTTACATAATGATAAAGG - Intronic
944912824 2:204327072-204327094 AAGGAGGGACAAAATGAGGGAGG + Intergenic
945531294 2:210956597-210956619 GAGTAGTGAAAAAAAGAGGATGG - Intergenic
945659641 2:212669668-212669690 GAGAAGTTACAAAATGAATAAGG - Intergenic
945831738 2:214795535-214795557 AAGAATGTAGAAAATGAGGAAGG + Intronic
946103177 2:217344982-217345004 AAATATTTACTAAATGATGATGG - Intronic
946801562 2:223422562-223422584 AAATATTTACTAAAAGAGGATGG + Intergenic
947423576 2:229962270-229962292 AAGTAGTTAGAAAATGAATATGG - Intronic
947784718 2:232806645-232806667 AGGTACTTACCATATGAGGAGGG - Exonic
947984673 2:234438140-234438162 AAATAGGCACACAATGAGGAAGG - Intergenic
948774144 2:240273039-240273061 AAGTAGTTGGAAATTGAGGAAGG - Intergenic
1168823019 20:789291-789313 AAGTACTTACAGAACCAGGAAGG - Intergenic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1170131797 20:13028680-13028702 AAGTAGATACAAGATAAGAATGG + Intronic
1170239690 20:14150202-14150224 AAGAAGTTAAAAACTGAGGTCGG + Intronic
1170562381 20:17569317-17569339 AAGTAGGTAAAAAATGCGGGAGG + Intergenic
1170912159 20:20583541-20583563 TGGGACTTACAAAATGAGGATGG + Intronic
1171178686 20:23075146-23075168 AGATAGGTACAAAGTGAGGAAGG + Intergenic
1171261853 20:23741095-23741117 AAGTACTTACAGAATCAGGAAGG + Intergenic
1171270988 20:23816975-23816997 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172340910 20:34156737-34156759 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172826275 20:37789542-37789564 AATTAGTCAGGAAATGAGGATGG + Intronic
1177453068 21:21297197-21297219 AATGAGTTAAAAAATGAGTAAGG + Intronic
1178109520 21:29356388-29356410 AAGTACTTACAGTATCAGGAAGG - Intronic
1178836958 21:36106471-36106493 AAGTACTTACAGAATCAGGAAGG + Intergenic
1179944515 21:44662560-44662582 AAGTAGACAGAAAATCAGGAAGG + Intronic
1180492270 22:15861786-15861808 TAGTAATTTTAAAATGAGGATGG - Intergenic
1181376234 22:22460324-22460346 ACGTGGTGACAAAAAGAGGAGGG + Intergenic
1181901725 22:26161531-26161553 GAGAAGGGACAAAATGAGGAGGG + Intergenic
1183793365 22:40093059-40093081 AAGTAGGTATAAACTGTGGATGG - Intronic
949184361 3:1172167-1172189 AAGTAGGTACAAAGTTGGGAGGG - Intronic
950594749 3:13969820-13969842 AAGTACTTACAGAACCAGGAAGG - Intronic
950846347 3:16019496-16019518 AAGTACTTACAGAACCAGGAAGG - Intergenic
951020995 3:17780701-17780723 AAGTACTTAGAGAATCAGGAAGG + Intronic
952554813 3:34520062-34520084 AAGTACTTACAGAATCAGGAAGG - Intergenic
953475332 3:43201190-43201212 AAGTTTTTAAAGAATGAGGAAGG - Intergenic
953622455 3:44544829-44544851 AAGTACTTGCAGAATCAGGAAGG - Intergenic
954599288 3:51855293-51855315 AAGAACTTACAGAATCAGGAAGG + Intergenic
954604582 3:51898946-51898968 AAGTACTTACAGAATCAGGAAGG + Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955543270 3:60000562-60000584 TAGTAGCCACAAAATTAGGATGG - Intronic
956643117 3:71432988-71433010 AAGCAGGTACAAAATGATCAGGG - Intronic
956842588 3:73154352-73154374 AAGTACTTACAGAATCAGAAAGG - Intergenic
957975705 3:87441703-87441725 TAGTAGTTACAAAATGTCAAAGG + Intergenic
958551233 3:95616165-95616187 TAGCAGTCACAACATGAGGAAGG + Intergenic
958601589 3:96301739-96301761 AACTACTCACAAAATCAGGAAGG + Intergenic
959809370 3:110596814-110596836 AACCTGTTACAAAATGGGGAGGG - Intergenic
960063972 3:113351127-113351149 AAGTACTTACAGAATCAGGAAGG + Intronic
960720497 3:120620856-120620878 AAGTACTTACAGAACCAGGAAGG - Intergenic
961515681 3:127433004-127433026 AAGCAGTAACAAGAGGAGGATGG + Intergenic
961560917 3:127729579-127729601 AAGAAGTTCCAAAATGTAGATGG + Intronic
961761715 3:129174728-129174750 GAGAAGATACAAAATGAAGATGG - Intronic
961969882 3:130951209-130951231 AAGTGGTTACAAAATTGGGGAGG + Intronic
963693475 3:148535152-148535174 AATAAGTTATAAAATGAGGAAGG - Intergenic
963697228 3:148576800-148576822 AAGTACTTACAGAATCAGGAAGG + Intergenic
963991808 3:151664892-151664914 AAGTACTTACAGAATCAGGAAGG - Intergenic
964064912 3:152565391-152565413 AAGTAGTTATATAATGAGCTCGG - Intergenic
964422396 3:156517540-156517562 AAGAAGGTATAAAAAGAGGAAGG + Intronic
964972487 3:162578813-162578835 AAGTACTCACAGAATCAGGAAGG + Intergenic
965139697 3:164817508-164817530 AAGTACTTACAGAATCAGGAAGG + Intergenic
966302048 3:178490027-178490049 ACATAGTTACTAAAGGAGGAAGG - Intronic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966784617 3:183611768-183611790 AAGTAGTCAGAAAATCAGTAAGG + Intergenic
967257100 3:187604456-187604478 AAGAAGTTATAAAATTTGGAAGG - Intergenic
969948757 4:10812013-10812035 AAATAGTCACCAACTGAGGATGG - Intergenic
970743612 4:19267598-19267620 AAGTGGTTAGAAAATGGGAATGG - Intergenic
970751966 4:19374628-19374650 ATGTCGTAACAAAAGGAGGAGGG - Intergenic
970792084 4:19869487-19869509 AAGTAATAACAAATTCAGGAAGG - Intergenic
970807374 4:20052182-20052204 AATGAGTTAGAAAATGAGGGTGG - Intergenic
970996667 4:22275527-22275549 AAGTAGTTACCAGATGATGGGGG + Intergenic
971020961 4:22534888-22534910 AAGTAATTCCAAAAGGAAGATGG - Intergenic
971224878 4:24742660-24742682 AACTTGTTATAAAATGTGGAAGG + Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971749915 4:30633620-30633642 AAGTAATTAATGAATGAGGATGG - Intergenic
971992404 4:33916242-33916264 AATTAGATACAAATTAAGGAGGG - Intergenic
972651336 4:41020504-41020526 AAGTACTTACAGAATCAGGAAGG + Intronic
972784833 4:42316735-42316757 AAGTACTTACAGAATCAGGAAGG + Intergenic
973887827 4:55340549-55340571 AAATACTTACAGAATCAGGAAGG + Intergenic
974457675 4:62148751-62148773 AAGTAGTTACATTATGAGGGTGG - Intergenic
974485610 4:62501245-62501267 AAATATTTATAAAATGACGAAGG + Intergenic
975068466 4:70100647-70100669 AAGTAATTACAAAATGGGCCGGG + Intergenic
975472573 4:74787247-74787269 TATTAATTACAAAATGGGGATGG - Intronic
975873055 4:78803246-78803268 AAGAAGTTACCAAAAAAGGAGGG - Intronic
976768781 4:88628098-88628120 AAGCAGATACAAAATTAGTAAGG - Intronic
976888552 4:90015759-90015781 AGGAATTTACCAAATGAGGAAGG - Intergenic
977640666 4:99354911-99354933 AAGTACTTACAGTATCAGGAAGG + Intergenic
977834454 4:101632301-101632323 AAGTACTTACAGAATCAGAAAGG - Intronic
978060320 4:104328810-104328832 AAGTGGTTAAAAAAAGAGAATGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979427933 4:120591157-120591179 AAGTAGTTTCACAATGATAATGG + Intergenic
979452160 4:120885433-120885455 AACTTGTTAAATAATGAGGAAGG - Intronic
979783488 4:124685936-124685958 AAGTAGATATACATTGAGGAAGG + Intronic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
980281520 4:130728785-130728807 AAGAAGTTAAAAAATTAGAAGGG + Intergenic
980438943 4:132816468-132816490 AAGTACTTACAGAACCAGGAAGG - Intergenic
981026652 4:140083471-140083493 AAGTAGTCAGAAAAACAGGAAGG + Intronic
981488087 4:145308867-145308889 AGGTTGTTATAAAATCAGGATGG - Intergenic
981837142 4:149067211-149067233 AAAAAGTTAAAAAGTGAGGAGGG + Intergenic
982701620 4:158664031-158664053 AAGTACTTGCAGAATCAGGAAGG + Intergenic
982724550 4:158891634-158891656 CAGTACTTACAAAATCAGCAGGG - Exonic
982877523 4:160666541-160666563 AAGTACTTACAGAATCAGGAAGG + Intergenic
983365526 4:166782413-166782435 AAGTAGATAGAAAAAGAGTAAGG + Intronic
983834450 4:172371060-172371082 AAGTACTTACAGAATCAGGAAGG - Intronic
987598668 5:20036421-20036443 AAGGAGTGAAAAAAAGAGGAGGG + Intronic
987931063 5:24399719-24399741 GAGTACTTACAGAATCAGGAAGG + Intergenic
988358260 5:30203707-30203729 AATTACTTACAGAATTAGGAAGG + Intergenic
989193990 5:38698292-38698314 AGGTTGTTACAAAGTGAGGTTGG - Intergenic
989259549 5:39403797-39403819 AGGTGGGTACAAAATTAGGATGG - Intronic
989507155 5:42239526-42239548 AACTACTTACAAAAACAGGAAGG + Intergenic
989613736 5:43319161-43319183 AAGTACTTACAGAACCAGGAAGG - Intergenic
989670066 5:43906242-43906264 AAGTAGTTACAAAATTCTGGTGG + Intergenic
989964132 5:50449288-50449310 AAGTACTTACAGAATCAGGAAGG - Intergenic
990367489 5:55085843-55085865 AGGTACTTACAGAATCAGGAAGG - Intergenic
990419392 5:55616641-55616663 AAGTACTTACAGAATCAGGAAGG + Intergenic
990644468 5:57828396-57828418 AAGGAGTTAACAAAGGAGGATGG + Intergenic
990756182 5:59073212-59073234 ACATAGTTATAAAATGATGAGGG + Intronic
993055327 5:82973953-82973975 AAATACTTACAGAATCAGGAAGG - Intergenic
993335032 5:86646469-86646491 AAGTATCAACAAAATGAAGAGGG + Intergenic
994022395 5:95042758-95042780 AAGGTGTTACTAAATGAGAAAGG - Intronic
994027047 5:95096495-95096517 AAGTAGTGAAAAAATGGGAAGGG + Intronic
994150575 5:96442966-96442988 AAATGGTTACAAAAAGAAGAAGG - Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
995802024 5:116007419-116007441 AAATAGGTAGAAAAAGAGGAAGG - Intronic
996098879 5:119427705-119427727 AAGTACTTACAGAAACAGGAAGG - Intergenic
996100344 5:119438872-119438894 AAGTACTTACAGAATCAGGAAGG + Intergenic
998895369 5:146793205-146793227 AAGTTGTTATCAACTGAGGAAGG + Intronic
998915422 5:147006279-147006301 AAGTACTTACAGAATCAGGAAGG + Intronic
999770720 5:154773681-154773703 AAGTAGTTCCAAAACCAGGCAGG - Intronic
1000807887 5:165819733-165819755 AAGTAGTTCAAAAATGAGCCTGG - Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001691644 5:173637310-173637332 AAAAAGTAACAAAATGAGGCTGG + Intergenic
1002937368 6:1685013-1685035 AAGTAGTTAAAAAAAAAGGGGGG - Intronic
1003914961 6:10778281-10778303 AAGTAAATACATAATGAGCAGGG + Intronic
1004493044 6:16135411-16135433 AAGCAGTTAAAAGATGTGGAGGG - Intronic
1004812718 6:19277252-19277274 AAGTCCTTACAGAATCAGGAAGG + Intergenic
1005669459 6:28090697-28090719 TAATAGTTACAAAATGAGATAGG - Intergenic
1006222072 6:32499636-32499658 AAGTACTTACAGAATCAGGAAGG + Intergenic
1006619334 6:35352027-35352049 AACAAGTTAAAAAATGAGGTGGG - Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1008159413 6:48059343-48059365 AAGAAGTTAAAAAATGGGCAGGG + Intronic
1008180677 6:48324570-48324592 AATAAGTTACAATATCAGGATGG - Intergenic
1008671368 6:53772539-53772561 AAGAGGTTATAAAATGAGGTTGG - Intergenic
1008764259 6:54892030-54892052 AAGTAATTACCAAATGTAGAGGG - Intronic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1009450544 6:63794966-63794988 AAGTAGTAAAAAGAGGAGGAAGG + Intronic
1010075304 6:71790847-71790869 AAGTACTTACAGAATCAGGAAGG + Intergenic
1010864389 6:80956061-80956083 AAGAAGTTACAAAAAAGGGAAGG + Intergenic
1011449995 6:87482482-87482504 AAGTACTTACAGAATCAGGAAGG - Intronic
1012426274 6:99118260-99118282 GAGAAGTTAAAAAATGAGTATGG + Intergenic
1012441059 6:99262776-99262798 AAGTACTTACAGAATCAGGAAGG - Intergenic
1012814759 6:104009198-104009220 AAGCACTTATAACATGAGGAGGG - Intergenic
1013303637 6:108827706-108827728 AAGTATTTTCAAAATGATGGTGG + Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1015008876 6:128318660-128318682 AGGTTGTTACTAAATGAGGCAGG - Intronic
1015839997 6:137466824-137466846 AGATAGTTTCAAAATGAGAACGG - Intergenic
1016722438 6:147317467-147317489 TAGTAGACACAACATGAGGAAGG + Intronic
1017601327 6:156085362-156085384 AAGTAGATATAAAATCAGTAAGG - Intergenic
1017989660 6:159475112-159475134 CATGAGTTACAAAATGGGGATGG + Intergenic
1018191525 6:161313553-161313575 AAGTGCTTACAGAATCAGGAAGG - Intergenic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1020184264 7:5946939-5946961 AAGCAGTTAGGAAATGTGGAGGG - Intronic
1020298653 7:6777827-6777849 AAGCAGTTAGGAAATGTGGAGGG + Intronic
1020655581 7:10924808-10924830 AAGTATTTACAGAACCAGGAAGG + Intergenic
1021356119 7:19654968-19654990 AAGTATGTACAGAATCAGGAAGG - Intergenic
1023077735 7:36500469-36500491 AAGTACTTACAGAATCAGGAAGG - Intergenic
1023436484 7:40145745-40145767 AAGTACTTACAGAATCAGGAAGG - Intronic
1023798955 7:43816388-43816410 AAGTACTTACAGAATCAGGAAGG + Intergenic
1024164844 7:46720675-46720697 AAATAATTACAACAGGAGGAAGG - Intronic
1024951687 7:54867457-54867479 AAGTAGATAGAAAATGAATAAGG - Intergenic
1025167339 7:56724037-56724059 TAGTAGTAAAAAAGTGAGGAGGG + Intergenic
1025798232 7:64759681-64759703 AAGTACTTACGGAATCAGGAAGG - Intergenic
1028667055 7:93357904-93357926 AAGTGTTTACAAAATGTAGAGGG + Intronic
1028951729 7:96644010-96644032 AAGTTGTTACAAAGTGATGGTGG - Intronic
1029143480 7:98429001-98429023 AAGTATTTAAAAAAATAGGATGG + Intergenic
1030015480 7:105215888-105215910 AAATAGTTATAAAATTAAGAGGG + Intronic
1030119217 7:106090314-106090336 AAGTATTTTCTAAATGAGGTCGG + Intergenic
1030372244 7:108713641-108713663 AAGTGGGTACCAGATGAGGAGGG + Intergenic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1030656405 7:112173280-112173302 AAGTAATTATAAATTGGGGAGGG - Intronic
1030693140 7:112555519-112555541 AACTAGTTACAAAAAGAGTTAGG + Intergenic
1030724566 7:112910975-112910997 AAGTCCTTCCAAAATGAGAAGGG + Intronic
1031732261 7:125314035-125314057 AAGTACTTACAGAATTAGGGAGG + Intergenic
1032849108 7:135777665-135777687 AAATAGGTACAATATGAGAAAGG + Intergenic
1034041832 7:147886023-147886045 AAGCAGCTACAAAATGGGAAGGG - Intronic
1034579414 7:152029611-152029633 AAGTACTTACAGAATCAGGAAGG - Intronic
1035794719 8:2344256-2344278 AAGTAGATACAGACTGATGAGGG + Intergenic
1035871488 8:3140418-3140440 AAGTAGTAAGAAAATAAAGAAGG + Intronic
1035948576 8:3993242-3993264 AAATAATAACAACATGAGGAGGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1040667416 8:49651120-49651142 AAGTACTTACAGAATCAGGAAGG - Intergenic
1041219736 8:55637284-55637306 CAGTAGTTGGAAAATGAGAAGGG + Intergenic
1041535555 8:58921668-58921690 AAGTATTTACAAAATTTGTAGGG - Intronic
1041573492 8:59365853-59365875 AAAAAATTACAAAATGAGAAGGG - Intergenic
1041684672 8:60632534-60632556 AGGTGGGTACAAAATGAGGGGGG - Intergenic
1042088064 8:65130447-65130469 AAGTACTTACAGAACCAGGAAGG - Intergenic
1042917810 8:73892555-73892577 AAGGAGTGAGAAAGTGAGGATGG + Intergenic
1043020465 8:74993710-74993732 AAGTAGTTTCAATAGGAGAATGG + Intronic
1043490967 8:80748769-80748791 AGGAAGTTAAAAAACGAGGAAGG + Intronic
1043613336 8:82092932-82092954 AAGTACTTACAGAATCAGGAAGG - Intergenic
1044456189 8:92395027-92395049 AAGTACTTACAGAATCAGGAAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045636902 8:104201317-104201339 AAGTTGTTACAAAATTAGCTTGG - Intronic
1045704534 8:104906070-104906092 AAATAGGTAGAAAATCAGGAAGG + Intronic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046831640 8:118752619-118752641 AGGTAGTTAGGTAATGAGGATGG + Intergenic
1047444746 8:124909439-124909461 AAGTACTTACAGAATCAGGAAGG + Intergenic
1047883518 8:129222194-129222216 AAATACTTATTAAATGAGGAAGG - Intergenic
1050045238 9:1536767-1536789 AAGTATTTACAAAACATGGAAGG - Intergenic
1050886656 9:10775418-10775440 GAGTAGTGACAAAATGATGAAGG - Intergenic
1051040584 9:12804897-12804919 AAGTATTTACAAAAACAGGTGGG - Intronic
1052128884 9:24815765-24815787 AAGTAGTTAAAAAGTTAGGCAGG + Intergenic
1052190852 9:25659558-25659580 ACATAGTTCCAAAATGATGAAGG + Intergenic
1052289982 9:26829450-26829472 AAGTACTTACAGAATCAGGAAGG + Intergenic
1052486623 9:29109692-29109714 AATTTGTTACGAAATGAAGATGG - Intergenic
1053422473 9:37988145-37988167 AAGCAGTTCCAAAGTGAAGAAGG - Intronic
1054318926 9:63632475-63632497 AAGTGGTTACATCATGAGGTTGG + Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055457959 9:76490674-76490696 AAGTACTTACAGAATCAGGAAGG - Intronic
1056414590 9:86364255-86364277 AAGTACTTACAGAACAAGGAAGG - Intergenic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1060136558 9:121161077-121161099 AAGTAGGTAAAAAATGAATATGG + Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1185751970 X:2618687-2618709 AAGTTCTGAGAAAATGAGGAAGG - Intergenic
1185807998 X:3078348-3078370 AAGTAGTTAAAAAATTAGCCAGG - Intronic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186899643 X:14040052-14040074 AAGTAGTGACACAACCAGGAAGG - Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1188068305 X:25688387-25688409 ATGTACATACAAAATGAGGCTGG + Intergenic
1188105980 X:26147365-26147387 GAGTAGTTAAAAAGTGAGGTGGG - Intergenic
1188209229 X:27399331-27399353 AAGTAGGTACAAATAGAGAAAGG + Intergenic
1189034422 X:37480915-37480937 AAGTACTTACAGAACCAGGAAGG + Intronic
1189621979 X:42851306-42851328 GAGTTGTTAAAAAATCAGGAAGG + Intergenic
1189834028 X:45003088-45003110 AAGTACTTACAGAACCAGGAAGG - Intronic
1190557906 X:51655273-51655295 AAGTAGTAAGACAATGAGTAAGG - Intergenic
1191586249 X:62829677-62829699 ATGTAGGTACAAAAAGGGGATGG + Intergenic
1191890053 X:65930732-65930754 ACGTACTTACAGAATCAGGAAGG - Intergenic
1192482291 X:71496014-71496036 AAGTACTTACAGAATCAGGAAGG - Intronic
1193327351 X:80194934-80194956 AACTATTTACAAAATGAAAAGGG - Intergenic
1193843996 X:86446086-86446108 AAGTAATTACATAATGATAAAGG - Intronic
1194909335 X:99620487-99620509 TAGTAGTTAGAGAATGGGGAAGG + Intergenic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1195754346 X:108186589-108186611 AAGAAGTTATATAAAGAGGAAGG + Intronic
1195847040 X:109240123-109240145 AAGTACTTACAGAACCAGGAAGG - Intergenic
1195866058 X:109434151-109434173 GAGTAGTCAGAAAATGAAGAGGG + Intronic
1196126901 X:112110679-112110701 AAGTACTTACAGAATCAGGAAGG - Intergenic
1196336274 X:114540069-114540091 AAATAGTTTGAAAATAAGGAGGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197610718 X:128635352-128635374 AGGTAGATAGATAATGAGGAAGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198742328 X:139854195-139854217 AAGTACTTACAGAATCAGGAAGG + Intronic
1199252749 X:145682891-145682913 GAGTTGTCACAAAATGAGGTGGG - Intergenic
1199278422 X:145972301-145972323 AAGTATTTACACAACCAGGAAGG + Intergenic
1199764075 X:150928002-150928024 AAGTATTTTCAAACTGAGGTTGG + Intergenic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200711594 Y:6489614-6489636 ATGTACTTACAGAATCAGGAAGG + Intergenic
1200763419 Y:7060730-7060752 AAGTACTTACAGAACCAGGAAGG - Intronic
1200945527 Y:8831646-8831668 AAGTACTTACAGAATCAGAATGG + Intergenic
1201022339 Y:9672365-9672387 ATGTACTTACAGAATCAGGAAGG - Intergenic
1201271739 Y:12262394-12262416 AAGTACTTACAGAATCAGGAAGG - Intergenic
1201297298 Y:12474795-12474817 AAGTACATACAAAACCAGGAAGG - Intergenic
1201568175 Y:15387807-15387829 AAGTACTTACAGAATCAGGACGG - Intergenic
1201648550 Y:16261762-16261784 AAGTACTTACGGAATCAGGAAGG - Intergenic
1201654260 Y:16323539-16323561 AAGTACTTACGGAATCAGGAAGG + Intergenic
1201900040 Y:19039808-19039830 AAGTACCTACAGAATCAGGAAGG - Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic
1202089673 Y:21176709-21176731 AAGTACTTACAGAATCAGGAAGG - Intergenic