ID: 1030563358

View in Genome Browser
Species Human (GRCh38)
Location 7:111119813-111119835
Sequence CCTTGATCCTTTCCTTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030563358_1030563362 11 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563362 7:111119847-111119869 AGAAACAAGTGCTGGAGCCATGG 0: 1
1: 0
2: 4
3: 26
4: 355
1030563358_1030563360 3 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563360 7:111119839-111119861 TGCCTGACAGAAACAAGTGCTGG No data
1030563358_1030563363 12 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563363 7:111119848-111119870 GAAACAAGTGCTGGAGCCATGGG No data
1030563358_1030563364 25 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG No data
1030563358_1030563365 26 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563365 7:111119862-111119884 AGCCATGGGACCACTGTGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 158
1030563358_1030563366 27 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563366 7:111119863-111119885 GCCATGGGACCACTGTGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563358 Original CRISPR CCTTGATCCTTTCCTTCACC AGG (reversed) Intronic