ID: 1030563360 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:111119839-111119861 |
Sequence | TGCCTGACAGAAACAAGTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1030563358_1030563360 | 3 | Left | 1030563358 | 7:111119813-111119835 | CCTGGTGAAGGAAAGGATCAAGG | 0: 1 1: 0 2: 3 3: 19 4: 199 |
||
Right | 1030563360 | 7:111119839-111119861 | TGCCTGACAGAAACAAGTGCTGG | No data | ||||
1030563354_1030563360 | 28 | Left | 1030563354 | 7:111119788-111119810 | CCTCACGCTCTCAAGGAGGTTAG | No data | ||
Right | 1030563360 | 7:111119839-111119861 | TGCCTGACAGAAACAAGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1030563360 | Original CRISPR | TGCCTGACAGAAACAAGTGC TGG | Intronic | ||