ID: 1030563361

View in Genome Browser
Species Human (GRCh38)
Location 7:111119841-111119863
Sequence CTCCAGCACTTGTTTCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030563361_1030563369 16 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563369 7:111119880-111119902 AAGGGGCAGCTAAGTACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 98
1030563361_1030563374 25 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563374 7:111119889-111119911 CTAAGTACATGTGGAGGGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 219
1030563361_1030563373 24 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563373 7:111119888-111119910 GCTAAGTACATGTGGAGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 168
1030563361_1030563365 -2 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563365 7:111119862-111119884 AGCCATGGGACCACTGTGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 158
1030563361_1030563370 19 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563370 7:111119883-111119905 GGGCAGCTAAGTACATGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
1030563361_1030563372 23 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563372 7:111119887-111119909 AGCTAAGTACATGTGGAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 129
1030563361_1030563366 -1 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563366 7:111119863-111119885 GCCATGGGACCACTGTGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1030563361_1030563371 20 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563371 7:111119884-111119906 GGCAGCTAAGTACATGTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1030563361_1030563364 -3 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563361 Original CRISPR CTCCAGCACTTGTTTCTGTC AGG (reversed) Intronic