ID: 1030563363

View in Genome Browser
Species Human (GRCh38)
Location 7:111119848-111119870
Sequence GAAACAAGTGCTGGAGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030563358_1030563363 12 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563363 7:111119848-111119870 GAAACAAGTGCTGGAGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563363 Original CRISPR GAAACAAGTGCTGGAGCCAT GGG Intronic