ID: 1030563364

View in Genome Browser
Species Human (GRCh38)
Location 7:111119861-111119883
Sequence GAGCCATGGGACCACTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030563358_1030563364 25 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG No data
1030563361_1030563364 -3 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG 0: 1
1: 0
2: 4
3: 49
4: 858
Right 1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563364 Original CRISPR GAGCCATGGGACCACTGTGA AGG Intronic
No off target data available for this crispr