ID: 1030563366

View in Genome Browser
Species Human (GRCh38)
Location 7:111119863-111119885
Sequence GCCATGGGACCACTGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030563358_1030563366 27 Left 1030563358 7:111119813-111119835 CCTGGTGAAGGAAAGGATCAAGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1030563366 7:111119863-111119885 GCCATGGGACCACTGTGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1030563361_1030563366 -1 Left 1030563361 7:111119841-111119863 CCTGACAGAAACAAGTGCTGGAG No data
Right 1030563366 7:111119863-111119885 GCCATGGGACCACTGTGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563366 Original CRISPR GCCATGGGACCACTGTGAAG GGG Intronic