ID: 1030563582

View in Genome Browser
Species Human (GRCh38)
Location 7:111122431-111122453
Sequence CTGCAAATACTGAAGAAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030563582 Original CRISPR CTGCAAATACTGAAGAAGCA TGG Exonic
906280476 1:44549950-44549972 CTCCAAAAAGTGAAGCAGCAAGG + Intronic
907375219 1:54032192-54032214 CTGAAGATCATGAAGAAGCAGGG - Exonic
907476348 1:54708488-54708510 CTGCAAATACTGCAGGAGCCAGG + Intronic
908552133 1:65219665-65219687 ATGCTAATAATGAAGAAGCTAGG - Intronic
908650949 1:66332381-66332403 GTGCAAATAATGAAGGAGCACGG + Intronic
909749105 1:79136709-79136731 AAGCAAATACTAAAGAAGTAGGG - Intergenic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
915811292 1:158914795-158914817 CCGAAAATCCTGAAGAAGAAAGG - Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916958832 1:169868635-169868657 CTTCTAATAGTGAAGAAGCTAGG - Intronic
917264909 1:173210590-173210612 CTGCAGCTACTGGAGAAACATGG + Intergenic
917603121 1:176597266-176597288 CTGAAAATACTGATAATGCAAGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
922031980 1:221810062-221810084 TTGCAAATAATAAAGAAACAGGG + Intergenic
922353461 1:224754875-224754897 TTACAGCTACTGAAGAAGCAGGG + Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923510390 1:234647073-234647095 CCACAAATACTCAACAAGCAGGG - Intergenic
1063523316 10:6760598-6760620 TTGGAAATATTGAAGAAACAAGG + Intergenic
1065021781 10:21507825-21507847 CTGCAAAGAAGGAAGAGGCAGGG + Intergenic
1065389431 10:25167733-25167755 ATGCAAATACTGAATAATTAAGG - Intergenic
1065762525 10:28995438-28995460 ATGTAAATATTGAAGAAGCATGG - Intergenic
1066336094 10:34480053-34480075 CTGCAAGGACTGCAGCAGCAGGG - Intronic
1068296727 10:55080576-55080598 CTGCAATTACTGCAGCAGCCAGG - Intronic
1071062260 10:81586054-81586076 CTGGAAATAATCAAGAATCATGG - Intergenic
1072824994 10:98598173-98598195 CTGCACATTTTGAAGAAGTAAGG + Intronic
1073807672 10:107117127-107117149 TTGCAAAAAGTGAAAAAGCATGG + Intronic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1074197496 10:111202382-111202404 CTGCAATTACTGAATAAGGAGGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1077995244 11:7446997-7447019 CTGCAAATAGTGAAGCAAAAGGG - Intronic
1078030182 11:7742324-7742346 CTGGAAATACTGAGGAATGAAGG + Intergenic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080399159 11:31918084-31918106 CTGCCTAGACTGAAGAGGCAGGG + Intronic
1082030986 11:47603315-47603337 ATACAAATAATGAAGAAGCTGGG - Intergenic
1082952386 11:58831068-58831090 CTGCCAATACGCAAGAGGCAGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084613509 11:70219180-70219202 CTGCTAAGAGTGAAGAAGAAGGG + Intergenic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1087091131 11:94274370-94274392 CTGCACATAGTTAGGAAGCATGG - Intergenic
1087219022 11:95526070-95526092 GGGCAAATACTAACGAAGCAGGG + Intergenic
1089410856 11:118241480-118241502 CTGAGAAGACTGAAGAAGTACGG - Intronic
1089951362 11:122530651-122530673 CTGCAAAGACTGAAACAGCCGGG + Intergenic
1090319795 11:125832362-125832384 CTGAAAATGTTGAAGAAGCTTGG - Intergenic
1090875374 11:130784307-130784329 CTGCACATACTGAAGAATGTAGG + Intergenic
1092389708 12:8065221-8065243 CTGCATGAACTGAAGTAGCAGGG + Intronic
1092744903 12:11664221-11664243 CTGCTAACACAGCAGAAGCATGG - Intronic
1094764508 12:33576871-33576893 CTGAAAAAACTAGAGAAGCAAGG + Intergenic
1095273608 12:40252573-40252595 CTGAAAATTGTAAAGAAGCAAGG - Intronic
1097600460 12:61685915-61685937 CTGCAAATACTAAAATTGCAAGG - Intergenic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1099599919 12:84721928-84721950 CTGAGAAAACTGCAGAAGCAAGG + Intergenic
1102208566 12:111107375-111107397 CAGGAAATCCTGAAGAAGAATGG - Intronic
1102742643 12:115221848-115221870 CTGCAAATACTTGGGAGGCAGGG + Intergenic
1105588804 13:21771740-21771762 GTGCAAATCCTGCAGAAGCCAGG + Intergenic
1108422426 13:50264904-50264926 CTGAAAACACTGAACAACCAAGG - Intronic
1110124005 13:71918772-71918794 TTTCAAGTACTGAAGCAGCACGG + Intergenic
1112847225 13:103658859-103658881 CTGCCAATGCTGAATAATCATGG - Intergenic
1113913084 13:113853773-113853795 CTGCAAATGCTGAGAAAGGAAGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115260715 14:31450463-31450485 CTGCAAAATCTGAAATAGCATGG - Intronic
1116497642 14:45582364-45582386 CAGGAAATACTTAAGAAACATGG - Intergenic
1116872437 14:50080999-50081021 CTGGAAATTCTGCAGAAACATGG - Intergenic
1116989256 14:51257186-51257208 CTGCAAATACTGAATAATTATGG - Exonic
1118257358 14:64216661-64216683 GTGCAAATAGTGAGCAAGCAAGG + Intronic
1120498455 14:85264161-85264183 CAGCTAATACTGTAGAAGAATGG - Intergenic
1121884371 14:97529720-97529742 CTCCAAAGGCTGAAGAAGCTGGG + Intergenic
1202933778 14_KI270725v1_random:64927-64949 CTGCAAAATATGAAGAAACAAGG + Intergenic
1125353359 15:38790722-38790744 CTGTAAATACTGGACAACCATGG + Intergenic
1127182069 15:56431424-56431446 ATGCAATTATTGAAGAAGAAAGG - Exonic
1127399453 15:58572038-58572060 CCGCAAATACTGCAAAAGCTTGG + Intergenic
1130787141 15:87112259-87112281 AACCAAATACTGAAGAAGAAAGG + Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1131037530 15:89233414-89233436 TAGCAAATACTTATGAAGCATGG + Intergenic
1131619786 15:94055364-94055386 CTGCACAGCCTGAAGAACCATGG + Intergenic
1131627798 15:94142163-94142185 ATGCAAAAACTGAAAAAGAAAGG - Intergenic
1132311724 15:100862321-100862343 CTACATATTCTGAAGAACCAAGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134809899 16:17158428-17158450 ATTCAAATACTTAACAAGCATGG - Intronic
1137536443 16:49330540-49330562 CTGTCAATTCTAAAGAAGCAGGG - Intergenic
1138110423 16:54319474-54319496 CTGCAAATACCTAAGAATAAAGG - Intergenic
1140273109 16:73483815-73483837 CTGCAAATTATGAAGAAAAATGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144210705 17:13012773-13012795 CTGCAAATTCCGAAGTATCAGGG - Intronic
1147455200 17:40533396-40533418 CAGGAAAAACTGAAGAACCAGGG - Intergenic
1150143948 17:62752461-62752483 CTGCCAAGGCTGAGGAAGCAAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152156172 17:78634410-78634432 GTGTAAATGCTGAAGAAGAAGGG + Intergenic
1153691673 18:7600683-7600705 CTGCAGCTAGTGAGGAAGCAGGG - Intronic
1153784699 18:8524270-8524292 CTGCAAAAACTAAAAAAGGACGG + Intergenic
1154941456 18:21116568-21116590 CTGCCCATACTGCAGAATCATGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1157312894 18:46565551-46565573 CTGCAGATACTGAGGAATGACGG - Intronic
1157436212 18:47671642-47671664 CTGCAAGTAATTAAGAACCATGG - Intergenic
1158008578 18:52702196-52702218 CTTCAAAGTCTGAGGAAGCAGGG - Intronic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1167686900 19:50962195-50962217 CTGAAACTACTGAAGAAGGTGGG - Intronic
1168383981 19:55947673-55947695 ATGGAAAAACTGAAGATGCATGG - Intergenic
925860498 2:8170820-8170842 CTGCCAATGGAGAAGAAGCATGG - Intergenic
926332189 2:11834850-11834872 CTGCAAATAAAAAAGGAGCAGGG + Intergenic
927415130 2:22871542-22871564 GTGAAAATAGGGAAGAAGCAGGG - Intergenic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929768417 2:44870301-44870323 TTGTAAATACTAAAGAATCAAGG + Intergenic
930849642 2:55945566-55945588 CTGAAAATGATGAAGAAACAAGG - Intergenic
931129004 2:59312000-59312022 CTGTAAGTTCTGAAGGAGCAGGG + Intergenic
931295294 2:60918194-60918216 CTCCAAATACTGCAGAATTAAGG + Exonic
931927349 2:67087589-67087611 CTACAAAGACTGAAGAATCCAGG - Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
932739291 2:74279482-74279504 CTGCAAATACTGAAGTTCCTAGG + Intronic
937709829 2:124967466-124967488 CTGCTAATACACAAGAAGAAAGG - Intergenic
938440286 2:131324285-131324307 CTGAAAATACTTAAGAAACTTGG - Intronic
939233574 2:139463064-139463086 CTGGAAATATTAATGAAGCAAGG - Intergenic
941707345 2:168673698-168673720 CTGCAATTACTGAAAAAGCAGGG - Intronic
942694008 2:178618199-178618221 CTGACAATCCTGTAGAAGCAAGG - Exonic
942974096 2:181993757-181993779 CTGCACATACTGAAGAGTTAAGG - Intronic
943202709 2:184849432-184849454 CTGCTAATAATGCAGAAGAATGG + Intronic
943270941 2:185802932-185802954 TTGCAAATACTGAATCAACAAGG - Exonic
943739189 2:191392331-191392353 CTACAAATAATCAAGAGGCAGGG + Intronic
944190052 2:196993248-196993270 CTGCAAATGCTGAAGAGTTAGGG - Intronic
944683161 2:202095396-202095418 ATGCACAAACTGAAGATGCAGGG - Intronic
945405286 2:209440134-209440156 TTGCAAATACTGTACAAACAAGG - Intronic
945485466 2:210390305-210390327 CTGCAAAGCCTGTAGCAGCAGGG - Intergenic
946067493 2:217001117-217001139 TTGAAAGTAGTGAAGAAGCAGGG - Intergenic
946988333 2:225300312-225300334 CTGGAAAGACTGAGGAGGCATGG + Intergenic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
1168970261 20:1926198-1926220 TTGCAGATTCTGGAGAAGCAGGG - Intronic
1169030296 20:2401444-2401466 CTGCCAATACTGTTTAAGCAGGG - Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170792722 20:19521239-19521261 CGGGAGGTACTGAAGAAGCAGGG - Intronic
1171790541 20:29519102-29519124 TTGAAGATGCTGAAGAAGCAAGG - Intergenic
1171857168 20:30357733-30357755 TTGAAGATGCTGAAGAAGCAAGG + Intergenic
1171969813 20:31557170-31557192 CTGCAAATTATGAAGACACATGG - Intronic
1173307355 20:41863060-41863082 CTGCAAAAATTGATGAGGCATGG - Intergenic
1173475736 20:43358064-43358086 CTGCCAATACTGAAGCAGCCAGG + Intergenic
1174268024 20:49345941-49345963 CTGCTAATACTGGGGTAGCAAGG - Intergenic
1175602503 20:60286508-60286530 CTGCAGATAATGATGCAGCAAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176595178 21:8687083-8687105 CTGCAAAATATGAAGAAACAAGG + Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177452182 21:21284308-21284330 ATGCAAATATAGAAGATGCAGGG + Exonic
1177584329 21:23070136-23070158 CTGCATATGCTGCAAAAGCATGG + Intergenic
1178011570 21:28292324-28292346 CTGAAGAGACTGAAGCAGCAGGG - Intergenic
1178036598 21:28590654-28590676 CTGCCAATTATGAAGCAGCAGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1180876217 22:19176430-19176452 TTGCAGATCCTGAAGAAGGAGGG - Exonic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
952541654 3:34373459-34373481 CTGCAAATCCGGAAAAACCAGGG + Intergenic
955825450 3:62941494-62941516 CAGCAGACACTGAAAAAGCAGGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
960254902 3:115501514-115501536 TTGTAAACACTGAAGAACCAAGG + Intergenic
960713408 3:120553481-120553503 CTGCAATTACAGAACAATCAAGG + Intergenic
962961724 3:140317355-140317377 CTGCAAAGACCAAAGAAGTAGGG + Intronic
962975940 3:140445924-140445946 TTGAAAATACTGTAGAAGCATGG + Intronic
963082274 3:141404919-141404941 CTGCAACTGCTGGAGAAGCAGGG - Intronic
963558444 3:146828640-146828662 ATGTAATTACTGAAGTAGCATGG + Intergenic
964835460 3:160933551-160933573 CTCCAAATAATGAGGAGGCAAGG - Intronic
966823977 3:183948068-183948090 CTGCTGCTACTGAAGGAGCATGG + Intronic
967496025 3:190145541-190145563 CTGCTAAGAGTGAAGAAGAAGGG - Intergenic
967928257 3:194670027-194670049 CTGCAAGTTCTGCAGTAGCAAGG + Exonic
970471031 4:16379531-16379553 GTGAAAATAATGAAGAGGCAGGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974326458 4:60420578-60420600 CTGCTAACACTTAAGAAGTAGGG + Intergenic
977014415 4:91675248-91675270 ATGCTAACACTGAAGAAGCTAGG - Intergenic
977048186 4:92092811-92092833 GTAAAAATACTGAAGAAGGAGGG - Intergenic
977114784 4:93010037-93010059 CTTCAAATACTGTAGAATAAAGG - Intronic
979351422 4:119648410-119648432 CTCCTAGAACTGAAGAAGCAAGG + Intergenic
980483888 4:133427186-133427208 CCCCAAATGCTGAAGAAGCCAGG - Intergenic
980981179 4:139655761-139655783 CTGTAAATACTGTAAGAGCAGGG + Intergenic
982090706 4:151877694-151877716 CTGCAGAGACTGTGGAAGCAGGG - Intergenic
982477866 4:155874681-155874703 TTGCAAATTCTGGAGAAGCCAGG + Intronic
982548343 4:156762957-156762979 CTGTAAATCCTGAAGATGAAAGG + Exonic
985434177 4:189913094-189913116 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
987309759 5:16670892-16670914 CTGCAGATACTGGAGTCGCAGGG + Exonic
987548384 5:19344224-19344246 CTGAAATTACTGAAGAAACAAGG - Intergenic
988262404 5:28905469-28905491 CTGAAAATACAGAAAATGCACGG + Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990692654 5:58381009-58381031 CTCCAAATTCTGAAGAAATAAGG - Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992522013 5:77563693-77563715 CTGCAGACACTGGAGAAACATGG + Intronic
992537750 5:77728104-77728126 GTGCAAATGCTAAAGAAACATGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995102308 5:108327486-108327508 CTGCAAAGAATGAAGATTCATGG + Intronic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
996855462 5:128000967-128000989 ATCCAAATAATGAATAAGCAGGG - Intergenic
997339215 5:133129579-133129601 CTGCAAATGGTGCAGAAGGACGG + Intergenic
997400680 5:133599461-133599483 TTGCAAATACTGAAAACCCATGG + Intronic
998701540 5:144707326-144707348 CTACAAATACTGAAGTATAAGGG + Intergenic
999848135 5:155507689-155507711 TTGCACATAGTAAAGAAGCAGGG - Intergenic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003586428 6:7393580-7393602 CTACAAATAGTTAAGAAACATGG + Intronic
1008057962 6:46964788-46964810 CTGCAAATACTGAACACGTTAGG + Intergenic
1009641541 6:66343427-66343449 CTGCAGATAAGGAAGAAGTAAGG + Intergenic
1009833537 6:68969512-68969534 CTGTCAGTACTGGAGAAGCATGG + Intronic
1010184251 6:73124710-73124732 CTGCAGATTTTGAAAAAGCAGGG - Intronic
1010725387 6:79327117-79327139 CTGAAAATAAGGAAGTAGCACGG - Intergenic
1011038696 6:83006338-83006360 CTCCAAATACAGGAAAAGCAGGG - Intronic
1011274093 6:85612031-85612053 CTACAATATCTGAAGAAGCAAGG + Intronic
1011859920 6:91741643-91741665 TTGCAAGTACTGAAAAATCAAGG - Intergenic
1012472528 6:99588347-99588369 CTGTAAAGACTGAAGAACCGTGG + Intergenic
1013332839 6:109122853-109122875 AAGCAAATTCTGAAGAAGGATGG - Intronic
1016165489 6:140936990-140937012 CTGAAAAAAGTGAAAAAGCATGG + Intergenic
1016557131 6:145351451-145351473 GTGGAAAGAGTGAAGAAGCAGGG - Intergenic
1018018037 6:159729749-159729771 CTGCAGACACTGTAGTAGCAAGG - Intronic
1018488023 6:164262350-164262372 CTGCAAAGACAGAAAAATCAAGG - Intergenic
1020357091 7:7289778-7289800 CTAAAAATACTAAAAAAGCAAGG - Intergenic
1021982292 7:26066553-26066575 GTGCAAATACTTCAGAAGAAGGG + Intergenic
1022250836 7:28606600-28606622 CTGCAAATTCTGTTGCAGCATGG + Intronic
1023072703 7:36452488-36452510 CTGCAGATACTAAAGAAGAGCGG + Exonic
1024671212 7:51597059-51597081 CTAAAAAAACTAAAGAAGCAAGG - Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1025713437 7:63931837-63931859 CTGCAAATCCTGAGAAAGGAAGG + Intergenic
1025758051 7:64363690-64363712 CTGCAAATCCTGCAGAGGAATGG - Intergenic
1025776987 7:64568884-64568906 CTGCATATATTGGGGAAGCAGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1028198789 7:87936385-87936407 ATGGTAAAACTGAAGAAGCAGGG + Intronic
1028226785 7:88261402-88261424 CAGCAAAAAATGAAGAAGAAAGG - Intergenic
1028305065 7:89252869-89252891 CTGGAAATACTGGGGAAGGAGGG + Intronic
1028354198 7:89886774-89886796 CTGGAAATCCTCAAGAAGGATGG - Intergenic
1028632850 7:92954723-92954745 CTGTACATACTGTAGAAGCATGG - Intergenic
1029519377 7:101050470-101050492 CTGCCAAGACTGAAGAGGGAAGG - Exonic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1031024213 7:116662712-116662734 ATGCAAATATTTAAGAAGGAAGG + Intergenic
1031604659 7:123754104-123754126 CTTCAAATACTGAAGAAAACTGG - Intergenic
1033911948 7:146274555-146274577 CTGCACATACTGAACAAATAGGG - Intronic
1035592397 8:826003-826025 ATGCAAATAGAGAAGAAGTACGG - Intergenic
1036198943 8:6750011-6750033 CTTCAACTACTGAATATGCATGG - Intronic
1037063294 8:14543632-14543654 CTGTAAAAACTGAGGAATCACGG + Intronic
1037346723 8:17909025-17909047 CTGATTAGACTGAAGAAGCATGG + Intronic
1040944389 8:52868344-52868366 TTTCAAATACTGAAGAAGACTGG + Intergenic
1042878906 8:73466257-73466279 CTGAAAATAATAAAGATGCATGG - Intronic
1043107273 8:76130040-76130062 CCTGAAACACTGAAGAAGCACGG + Intergenic
1043258357 8:78163276-78163298 CTGCATATATTGGAAAAGCAAGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044818535 8:96138414-96138436 CTATAACTACTGAGGAAGCAGGG - Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1050180849 9:2921064-2921086 CTGGAGCTACTGAAGAAGCAAGG - Intergenic
1050833728 9:10049315-10049337 CTGAAAGTATTGAAGATGCAGGG - Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051140055 9:13969161-13969183 CTGCGAACAGAGAAGAAGCATGG + Intergenic
1053723266 9:40971253-40971275 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
1054342698 9:63880739-63880761 CTGAAGATGCTGGAGAAGCAAGG - Intergenic
1057249302 9:93487055-93487077 CTGAAAATGATGAATAAGCACGG - Intronic
1185957882 X:4512210-4512232 CTGCTAAGTGTGAAGAAGCAAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188279565 X:28248137-28248159 TTTCAAATACTGAATATGCACGG - Intergenic
1192773344 X:74216425-74216447 CTGCAAATACTAGAGAAGAAAGG - Intergenic
1195010773 X:100731061-100731083 CCTCTAATCCTGAAGAAGCAGGG + Intronic
1195536733 X:106015898-106015920 CTGCAAATACAGAAGCAATAGGG + Intergenic
1196631644 X:117947643-117947665 CTTCAAAAGCTGAAGAAGCCTGG + Intronic
1199262431 X:145790910-145790932 GTGCAAATATTAAAAAAGCAGGG - Intergenic
1200109244 X:153731315-153731337 CAGCAGCTACAGAAGAAGCAGGG - Intronic
1202270517 Y:23067948-23067970 TTTCAAATTCTGAAGAAGCCAGG + Intergenic
1202295510 Y:23352734-23352756 TTTCAAATTCTGAAGAAGCCAGG - Intergenic
1202423511 Y:24701692-24701714 TTTCAAATTCTGAAGAAGCCAGG + Intergenic
1202447278 Y:24968393-24968415 TTTCAAATTCTGAAGAAGCCAGG - Intergenic