ID: 1030565949

View in Genome Browser
Species Human (GRCh38)
Location 7:111156017-111156039
Sequence CTATGACAACACAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030565949 Original CRISPR CTATGACAACACAAAGAACA TGG (reversed) Intronic
900070212 1:765248-765270 CTATAAGAACAAAAAGAAAAAGG + Intergenic
900946010 1:5831846-5831868 CCAACACAACACAGAGAACACGG + Intergenic
904159327 1:28511091-28511113 GTCTGCCTACACAAAGAACAAGG - Intronic
904821844 1:33250422-33250444 CTATGTCCATACAAAGGACATGG - Intergenic
905102567 1:35538067-35538089 CTATGGGAACACAAAGAATGGGG - Intronic
907174652 1:52507813-52507835 CTATCACAAAAAAAAGAAAAAGG - Intronic
910172577 1:84393409-84393431 CATTGAAAACACAAATAACATGG + Intergenic
910996588 1:93111366-93111388 CTATGAGAATACACAAAACACGG - Intronic
911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG + Intronic
911286057 1:95994560-95994582 CAATGTCAACACAGTGAACAAGG + Intergenic
912486989 1:110036563-110036585 CTATGACTAAAGAAAGATCATGG - Intronic
913032842 1:114928680-114928702 CTACCATAACACAAAGGACAGGG + Intronic
913661001 1:121006454-121006476 CTATGAGTACACAAAGCAAAAGG - Intergenic
913958489 1:143322699-143322721 CTATGGCAGGACAAAGACCACGG + Intergenic
914052806 1:144148079-144148101 CTATGGCAGGACAAAGACCACGG + Intergenic
914126391 1:144818462-144818484 CTATGGCAGGACAAAGACCACGG - Intergenic
914238531 1:145834707-145834729 CTATGACATCACAAAGCAGTAGG + Intronic
914451078 1:147792091-147792113 TAATTACAACACAAAGTACAGGG - Intergenic
914687244 1:149991621-149991643 AGATGACAACACACAGAACCAGG + Intronic
916027932 1:160851125-160851147 CCATAAAAACCCAAAGAACAAGG - Intronic
916401647 1:164455234-164455256 CAATAACAATACAAAGAACGTGG + Intergenic
916523870 1:165590998-165591020 CTATCACAATACATAGCACATGG + Intergenic
918322508 1:183377707-183377729 CAATAACAACAAAAAGTACAAGG + Intronic
918660347 1:187080431-187080453 CAATCAGAACACACAGAACAAGG + Intergenic
919012696 1:191985778-191985800 CTATAACAACAGACAGAAAAGGG - Intergenic
921738435 1:218655437-218655459 CGAAGACAACACTGAGAACAGGG - Intergenic
921801214 1:219404589-219404611 CTATGAAAACACACAAAAAAAGG + Intergenic
921808591 1:219485134-219485156 CAATAATATCACAAAGAACAAGG - Intergenic
922105576 1:222510659-222510681 CTATAAGAACAAAAAGAAAAAGG + Intergenic
922265918 1:223983286-223983308 CTATAAGAACAAAAAGAAAAAGG + Intergenic
922279164 1:224106513-224106535 CTATCCCAGCTCAAAGAACATGG - Intergenic
924347759 1:243088233-243088255 CTATAAGAACAAAAAGAAAAAGG + Intergenic
1063318875 10:5033705-5033727 CTATGAAAACACTATGAGCAAGG + Intronic
1064708457 10:18097169-18097191 ATAAGACAATACAAAGAACTTGG + Intergenic
1064887846 10:20131911-20131933 ATATGACACCTCAAGGAACAAGG - Intronic
1064977270 10:21131253-21131275 CTTTGAAAACAGAAAGCACAAGG + Intronic
1066267310 10:33788771-33788793 CTCTGAAAATTCAAAGAACACGG - Intergenic
1066728600 10:38416659-38416681 CTATAAGAACAAAAAGAAAAAGG - Intergenic
1066759172 10:38737865-38737887 CTATGGCAGGACAAAGACCAGGG - Intergenic
1068874531 10:61982163-61982185 CTGTGACAACTCAGAGCACACGG - Intronic
1068931900 10:62599097-62599119 CAAAGACATCACTAAGAACATGG + Intronic
1069643435 10:69972202-69972224 CTAGAACAACACAAATAGCAAGG - Intergenic
1070226370 10:74511242-74511264 CTATAATAACACAAACAGCATGG - Intronic
1071414488 10:85428491-85428513 CAATGAGAACACATGGAACATGG - Intergenic
1072779173 10:98233477-98233499 CCATGACAAGGCAAAGAAGATGG - Intronic
1073533875 10:104256801-104256823 CTATGAAAACAAAAAGATCCTGG - Intronic
1074323718 10:112427708-112427730 TTATCACAAAACAAAGAAGAAGG - Exonic
1075747908 10:124740908-124740930 CGTTGCCAACACAAAGCACATGG - Intronic
1075786440 10:125053273-125053295 CATTGTCAACACAAAGGACATGG + Intronic
1076974332 11:159981-160003 CTATAAGAACAAAAAGAAAAAGG + Intergenic
1077648570 11:3948930-3948952 CAATTACAACAAAAATAACATGG + Intronic
1079879741 11:25910995-25911017 CAATGACAACACTGTGAACAAGG + Intergenic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1080545947 11:33318687-33318709 CTATGACAATCAAAAGAAAAGGG - Intronic
1081639876 11:44745725-44745747 CTATTAAAAAACAAAAAACATGG + Intronic
1082251711 11:49989412-49989434 CAATAACAACACAAAGTAGAAGG - Intergenic
1085063258 11:73468414-73468436 TTATGGCAACCCTAAGAACATGG - Exonic
1085302908 11:75468740-75468762 CTCTGATACCACACAGAACAAGG + Intronic
1089734104 11:120537946-120537968 CTATGACAAGAAAAACCACATGG + Intronic
1090046434 11:123339035-123339057 CTATGAGTACACACAAAACATGG + Intergenic
1090592008 11:128282061-128282083 ATATGAATACACAAATAACAGGG - Intergenic
1090793451 11:130112842-130112864 GCATGACATCACAGAGAACAGGG - Intronic
1090953532 11:131495297-131495319 CAAGGACAACAGAAACAACAGGG - Intronic
1091128421 11:133123113-133123135 CTGTGACAACCCCAAGGACATGG + Intronic
1091156638 11:133380904-133380926 CCAAGACAACACCAAGAATAAGG + Intronic
1091207611 11:133832473-133832495 CTATGAAGACACAGAGAACGAGG + Intergenic
1093205421 12:16243120-16243142 ATACGACAAAACAAAGAGCATGG + Intronic
1093851419 12:24044225-24044247 GTATGACAACACAAAGATGAAGG + Intergenic
1094382670 12:29860160-29860182 CTATGAGAACACTAAGAAACAGG - Intergenic
1095764988 12:45885208-45885230 CTATGACAAAAGAAATATCAAGG - Intronic
1096418468 12:51434507-51434529 CTTTGGCAAGACAAAGAAAATGG + Intronic
1096531730 12:52246820-52246842 CTATGACAACAGAAGGCCCAGGG - Intronic
1098123720 12:67269163-67269185 GCATGACAACACAAAAAAAAGGG - Intergenic
1098423243 12:70327477-70327499 CCACGGCAACACAAAGAACTAGG - Intronic
1099525613 12:83715426-83715448 CAAAAACAAGACAAAGAACAAGG + Intergenic
1099606637 12:84810693-84810715 CTATAACAACTTAAAGAAAAAGG - Intergenic
1100398418 12:94205203-94205225 TCATGCCAACATAAAGAACAGGG - Intronic
1100681579 12:96929422-96929444 TTATGAAAACAAAGAGAACAAGG - Intronic
1100997366 12:100316849-100316871 CTTTGACACGACAAAGAACTGGG - Intronic
1101574891 12:105988197-105988219 CTCTCACTACACAAAGGACAAGG + Intergenic
1101820203 12:108178213-108178235 CTATGAAGACACAGAGAAGAGGG - Intronic
1103055838 12:117819431-117819453 TTATTTCAACACACAGAACAAGG + Intronic
1104327916 12:127817820-127817842 CTATGACAACACCTAGGACATGG - Intergenic
1105967099 13:25394959-25394981 CTGTGACAAGACAAAGGAAAAGG - Intronic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1108338641 13:49473731-49473753 CTATATCAAAACAAAGAACAAGG + Intronic
1108584451 13:51857476-51857498 TTATGACAACAAAATGAAAAAGG + Intergenic
1110584100 13:77167936-77167958 CAATGAAAAAACAAAGAATACGG + Intronic
1111620808 13:90722997-90723019 CAATGACAAAACACAGAAAAAGG + Intergenic
1112695175 13:101939966-101939988 ATATTACAACAGACAGAACAAGG + Intronic
1112950602 13:104991200-104991222 ATATGACAACATAGAGAAGAGGG - Intergenic
1112960262 13:105115719-105115741 CTATGATATCAGCAAGAACAAGG + Intergenic
1114127060 14:19740877-19740899 CTATGGTAACCAAAAGAACATGG + Intronic
1115449470 14:33529566-33529588 CTTTAACAACACAAAGGAAATGG - Intronic
1118393931 14:65319562-65319584 CTGGGGCAAAACAAAGAACAAGG + Intergenic
1120020144 14:79520488-79520510 CAATGAGAACACATGGAACAGGG - Intronic
1120544068 14:85788421-85788443 GTGTGAGAACACAAAAAACAAGG + Intergenic
1121004480 14:90480232-90480254 ATATGACAACTTAAAGAAAAAGG - Intergenic
1122403946 14:101487195-101487217 CTATGACAACAAAAACATGAAGG - Intergenic
1202929921 14_KI270725v1_random:27491-27513 CTATGGCAGGACAAAGACCAGGG - Intergenic
1123422384 15:20143752-20143774 CTATGGCAGGACAAAGACCAGGG + Intergenic
1123442618 15:20302590-20302612 CTATGGCAGGACAAAGACCAGGG - Intergenic
1123531612 15:21150292-21150314 CTATGGCAGGACAAAGACCAGGG + Intergenic
1124509219 15:30308000-30308022 CTCTGACAACAAAAAAAGCATGG + Intergenic
1124734341 15:32230662-32230684 CTCTGACAACAAAAAAAGCATGG - Intergenic
1128365520 15:66998556-66998578 TGATGAGAACACATAGAACATGG + Intergenic
1131060558 15:89401290-89401312 CCAGGACAACACAGAGAAGAGGG - Intergenic
1131998639 15:98158025-98158047 GTATGAAAAAACAAAGAACAAGG - Intergenic
1135825726 16:25726663-25726685 CTAAGTCAACTCAAAGAATATGG - Intronic
1136723619 16:32341322-32341344 CTATGGCAGGACAAAGACCAGGG + Intergenic
1136773323 16:32859013-32859035 CTATGGCAGGACAAAGACCAGGG - Intergenic
1136841951 16:33547367-33547389 CTATGGCAGGACAAAGACCAGGG + Intergenic
1136897291 16:34002506-34002528 CTATGGCAGGACAAAGACCAGGG + Intergenic
1137065478 16:35837319-35837341 CAAAAACAACACAAAGAAAAAGG + Intergenic
1137844812 16:51676752-51676774 TTTTGACAAAACAAAAAACAAGG - Intergenic
1138340589 16:56286602-56286624 CTAGGACATCACCAAGCACAAGG + Intronic
1140145448 16:72302594-72302616 CTATGGTCACACAAAGAGCATGG + Intergenic
1141204983 16:81926470-81926492 TTATAACAACACTAACAACACGG - Intronic
1141391892 16:83671779-83671801 CTATGGCAACAAGTAGAACAAGG + Intronic
1203002812 16_KI270728v1_random:176443-176465 CTATGGCAGGACAAAGACCAGGG - Intergenic
1203075743 16_KI270728v1_random:1121123-1121145 CTATGGCAGGACAAAGACCAGGG - Intergenic
1203134418 16_KI270728v1_random:1712849-1712871 CTATGGCAGGACAAAGACCAGGG - Intergenic
1203152116 16_KI270728v1_random:1847664-1847686 CTATGGCAGGACAAAGACCAGGG + Intergenic
1142461580 17:97798-97820 CTATAAGAACAAAAAGAAAAAGG + Intergenic
1143803569 17:9405906-9405928 CTATGACAACTTAAAGCAAAAGG - Intronic
1144574281 17:16419152-16419174 ATATGCGAAGACAAAGAACAGGG - Intronic
1145898543 17:28474875-28474897 CTATGACAAAAGGAAGAAAATGG - Intronic
1149120568 17:53158764-53158786 TTATGAGAACACAAACCACAAGG + Intergenic
1149158718 17:53665598-53665620 CTATGATACCATGAAGAACAAGG + Intergenic
1151069522 17:71192817-71192839 AAATGAGAACACAAAGAATAAGG - Intergenic
1203166955 17_GL000205v2_random:106239-106261 CTTTGAGAACACAAAGAATGGGG + Intergenic
1153461238 18:5335848-5335870 CTATGTCAACACAAAAAGAAAGG - Intergenic
1153929779 18:9867879-9867901 CGATGAGAACACATAGACCAGGG - Intergenic
1155194391 18:23459522-23459544 CTATGGGAACACAAAGGAAAGGG + Intronic
1156264918 18:35479094-35479116 CCATGACAACACAAACAAATAGG + Intronic
1158108664 18:53915028-53915050 CTATCACAACAAAAACAACATGG - Intergenic
1159086045 18:63792856-63792878 CTATGAATATACAAAGAAAAAGG - Intronic
1159425758 18:68283886-68283908 CTATCATAAGAGAAAGAACACGG - Intergenic
1159761835 18:72436371-72436393 CTAAGACAACAGAATGAAGAGGG - Intergenic
1160651282 19:230165-230187 CTATAAGAACAAAAAGAAAAAGG + Intergenic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1161979147 19:7621477-7621499 CTGTGAGAACCCCAAGAACAGGG + Intronic
1162679591 19:12330661-12330683 CTACTTCAACCCAAAGAACAGGG + Intronic
1162879622 19:13648649-13648671 AAATGACAACACAGAGAAAAAGG - Intergenic
1163191293 19:15678694-15678716 GTATGACAACACAGAGAACTGGG + Intronic
1163962920 19:20714112-20714134 CAATGAGAACACATGGAACAGGG + Intronic
1202692202 1_KI270712v1_random:100503-100525 CTATGGCAGGACAAAGACCACGG + Intergenic
925563328 2:5222223-5222245 CTATGAAAACAAAAACAACCAGG - Intergenic
925707822 2:6704707-6704729 CAATGACAGCACAAACAAGATGG + Intergenic
926499264 2:13633367-13633389 CTATCAAAACACAAAAGACATGG + Intergenic
927337479 2:21941695-21941717 CTGTGACTACACAAAGAACAGGG + Intergenic
927373486 2:22385310-22385332 GTAAAACAACAGAAAGAACAGGG - Intergenic
928252274 2:29691699-29691721 CTATGACAAAACAAAAAAGAAGG - Intronic
928852025 2:35759569-35759591 CTGTGAGAACATAAAGAAAATGG - Intergenic
930314626 2:49782526-49782548 CTTTGGCAAGACAATGAACAAGG - Intergenic
932152144 2:69382886-69382908 CTATGACATGGCAATGAACAAGG + Intronic
932723434 2:74157244-74157266 CCATAAAAACACAAAAAACAGGG + Intronic
932830935 2:74989322-74989344 CTATCACAACACAGAAAACCAGG + Intergenic
932951138 2:76295011-76295033 CTATGTTAACAAAAAGAAAATGG + Intergenic
932990691 2:76782039-76782061 CTATGACAACTTAAAGCAAAAGG - Intronic
933150543 2:78909746-78909768 GTATTACGACGCAAAGAACAGGG + Intergenic
933577090 2:84081462-84081484 CAATTAGAGCACAAAGAACAAGG + Intergenic
933954196 2:87353469-87353491 CTATGGCAGGACAAAGACCACGG - Intergenic
934238391 2:90249689-90249711 CTATGGCAGGACAAAGACCACGG - Intergenic
934274800 2:91567021-91567043 CTATGGCAGGACAAAGACCACGG + Intergenic
934460815 2:94213031-94213053 CTATGGCAGGACAAAGACCAGGG - Intergenic
934694904 2:96392724-96392746 CAATGACAGCACCAAGAAGATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
936392170 2:112085329-112085351 GGATGACAAAGCAAAGAACACGG - Intronic
937136228 2:119555843-119555865 CTTTGAGAGGACAAAGAACATGG + Intronic
937173155 2:119897637-119897659 CTATGAAAAAAGAAAGAAAATGG - Intronic
937803506 2:126108887-126108909 CTACTACATCACAAAGAAGAAGG - Intergenic
939585687 2:144002043-144002065 CTATGTCAACACAGTGAAAAAGG - Intronic
939674258 2:145052665-145052687 CTATGTCATCTAAAAGAACAGGG - Intergenic
940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG + Intergenic
941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG + Intergenic
941415582 2:165216888-165216910 GACTGACAACACAAACAACATGG + Intergenic
941431909 2:165423325-165423347 CTAAGACAACAGAAAGGAAATGG - Intergenic
941622954 2:167799089-167799111 CTATGGCAACATAAATAAGAGGG - Intergenic
944408375 2:199411740-199411762 CTAGAACAACTCACAGAACAGGG + Intronic
944539784 2:200744169-200744191 ATATGTCAAAACTAAGAACATGG - Intergenic
944818445 2:203404059-203404081 GTAGGACAATAGAAAGAACATGG - Intronic
945974481 2:216259575-216259597 CTATGACAAGACAAAAGACCTGG - Exonic
946672389 2:222119475-222119497 CAATGAGAACACATGGAACATGG - Intergenic
946977847 2:225173533-225173555 CTGTGACAAGACAAATAACTGGG - Intergenic
946978054 2:225175149-225175171 CTGTGACAAGACAAATAACTGGG + Intergenic
947045602 2:225979556-225979578 CTAGGACAACAGAATGAAAAGGG + Intergenic
948908515 2:240991452-240991474 CGATGACAGCAGAAAGCACAGGG + Intronic
1170028421 20:11917045-11917067 CTAAGACAGAACAAATAACAAGG - Intronic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1171798353 20:29583800-29583822 CCATGGAAAAACAAAGAACATGG + Intergenic
1172203383 20:33143337-33143359 CTATCAAAATACAAATAACATGG - Intergenic
1173336396 20:42115589-42115611 CTATGTCATCAAATAGAACAAGG + Intronic
1173779494 20:45742909-45742931 CTGTGACAACACAACAAAAACGG + Intergenic
1176404802 21:6352860-6352882 CTTTGAGAACACAAAGAATGGGG - Intergenic
1176432355 21:6636244-6636266 CTTTGAGAACACAAAGAATGGGG + Intergenic
1176591941 21:8656073-8656095 CTATGGCAGGACAAAGACCAGGG - Intergenic
1176704742 21:10105635-10105657 ATATGACAACACAAAGGAGCTGG + Intergenic
1177524342 21:22272632-22272654 CTATGGTAACAAAAACAACAGGG + Intergenic
1178483545 21:33002345-33002367 CTATGACTCCACAAAGGACAGGG + Intergenic
1180274789 22:10633202-10633224 CTATGGCAGGACAAAGACCAGGG - Intergenic
1180549254 22:16528118-16528140 CTATGGCAGGACAAAGACCAGGG - Intergenic
1181355436 22:22293718-22293740 CTATGGCAGGACAAAGACCAGGG + Intergenic
1181435786 22:22910044-22910066 CTAAGACAACACAAGGAGGACGG + Intergenic
952359977 3:32620902-32620924 CTATGGCAACCGACAGAACATGG - Intergenic
953529596 3:43728222-43728244 CTATGCCAACAAAAGCAACATGG + Intronic
956049124 3:65228675-65228697 CACTGAAAACACAAAGGACAAGG + Intergenic
956344918 3:68268037-68268059 ATTTTTCAACACAAAGAACAAGG - Intronic
957025376 3:75175833-75175855 CTATATAGACACAAAGAACATGG - Intergenic
957582161 3:82088048-82088070 CTAGGCCAACTCAGAGAACAAGG + Intergenic
957930201 3:86867830-86867852 CTTGGACAAAACAAAGAACTTGG + Intergenic
958512907 3:95072069-95072091 GTGTGACAACACGAAGAACCTGG + Intergenic
960315628 3:116173070-116173092 TTATGATAACTAAAAGAACAAGG + Intronic
960483880 3:118227189-118227211 CCATAACAACAAAAATAACAGGG + Intergenic
961430832 3:126881808-126881830 CTCTGACAAAAGAAAGAACGAGG + Intronic
962329817 3:134467673-134467695 CAATCAAAACACAAAAAACAAGG + Intergenic
962915998 3:139904280-139904302 CTGTGAGAACATAAAGAAAAAGG + Intergenic
962972934 3:140421666-140421688 CTGTGTGAGCACAAAGAACATGG - Intronic
963464727 3:145664982-145665004 CTCTTACAACAAAAAGGACAGGG - Intergenic
963582849 3:147148357-147148379 CTATGATAACCAAAACAACATGG + Intergenic
963595870 3:147323816-147323838 ATATCATAAAACAAAGAACAAGG + Intergenic
965078701 3:164010257-164010279 CAATGAGAACACACAGAAAAAGG + Intergenic
965357955 3:167700676-167700698 CTATGACAACTTAAAGCAAAAGG + Intronic
965379418 3:167969405-167969427 CTATAATAACAAAAACAACATGG + Intergenic
965550840 3:169963608-169963630 CTTTGGCAAAAGAAAGAACAGGG + Intergenic
966401335 3:179550596-179550618 CTATAGTAACACAAACAACATGG + Intergenic
966402262 3:179560191-179560213 ATCTGACAGCACAAAGAAGATGG - Intergenic
967857139 3:194126773-194126795 CTATGGCAATACAAACAGCATGG + Intergenic
968040749 3:195587275-195587297 CCATGAAAACACAAAGCAGATGG - Intergenic
968366551 3:198189814-198189836 CTATAAGAACAAAAAGAAAAAGG - Intergenic
968774917 4:2535102-2535124 CTATGACAAAGGAAAGGACAGGG + Intronic
969981256 4:11157996-11158018 CTATCATAACACACAGAATATGG + Intergenic
970032053 4:11686987-11687009 CAATGAAAACACAAAGTACATGG - Intergenic
970770212 4:19603182-19603204 CTATGAAATAACAAATAACATGG - Intergenic
971678865 4:29671188-29671210 CAATGACAACAAAAAAAACCTGG + Intergenic
971705238 4:30033194-30033216 CAATGACATGGCAAAGAACAAGG - Intergenic
973723832 4:53752214-53752236 CTATGTCAAGAGAAAGAAAAGGG + Intronic
974471721 4:62327523-62327545 TTATGAATAAACAAAGAACATGG + Intergenic
974513521 4:62876795-62876817 CTATAGTAACACAAACAACATGG + Intergenic
975049978 4:69851052-69851074 CAATGGCAACAAAAAGAATAGGG - Intronic
976109941 4:81661647-81661669 CTCTGAAAACTCAAAGCACAAGG + Intronic
976181291 4:82401580-82401602 CTATGGCAACCGATAGAACATGG - Intergenic
977982763 4:103344804-103344826 CTCTGACAAAAGAAAGAATATGG + Intergenic
979333378 4:119441055-119441077 CTATAAGAACAAAAAGAAAAAGG + Intergenic
980741326 4:136953242-136953264 GTATGAGAAATCAAAGAACATGG - Intergenic
981870664 4:149481632-149481654 CTATGGTAACCAAAAGAACATGG - Intergenic
983822535 4:172213098-172213120 CTATGAAACCACAAAAAAAAAGG - Intronic
984614796 4:181884721-181884743 TTTTGACAACTCAAGGAACAGGG - Intergenic
986989516 5:13535310-13535332 CTCTGACACCACAGGGAACATGG - Intergenic
987226805 5:15850458-15850480 CTGTGACACCACAAAGACCCAGG - Intronic
987728228 5:21731540-21731562 CAATGTCAACACAAAGCAGAGGG - Intergenic
987922396 5:24300137-24300159 CTATAATAACATAAACAACATGG + Intergenic
989333665 5:40289349-40289371 TTATGAAAAGACAAAGCACATGG + Intergenic
990032475 5:51278406-51278428 CAATGAGAACACATGGAACAGGG - Intergenic
990317144 5:54593557-54593579 ATATGAAAATACAAAGAACCTGG + Intergenic
990501920 5:56405098-56405120 GTATGACAACTCAGAAAACATGG - Intergenic
990632897 5:57690333-57690355 CAATGACTGCATAAAGAACATGG + Intergenic
991067293 5:62437738-62437760 CTATGACAACATAAATTACCTGG - Intronic
993116803 5:83728871-83728893 CTATGGCATCACTAAGAACAAGG - Intergenic
993638673 5:90376168-90376190 ATATGACAACAGAAAGCAAAAGG - Intergenic
994023080 5:95050621-95050643 TTTTGACAGCACAAAGAACCAGG + Intronic
994216068 5:97139022-97139044 CTATTACAACACTAATGACATGG + Intronic
995457290 5:112365911-112365933 CTCTGATAAGACAAAGTACAAGG + Intronic
995672992 5:114628217-114628239 CTATAAATAAACAAAGAACAAGG + Intergenic
996133889 5:119815066-119815088 CTATAACAATGCAAAGAACGAGG - Intergenic
996753780 5:126915320-126915342 TTGTGACAACACAAAGAAATAGG + Intronic
997748384 5:136320134-136320156 CTAGGACAACTGAAAGAATAGGG - Intronic
998737232 5:145156285-145156307 CTAATACAACACATAGACCACGG - Intergenic
999194324 5:149771712-149771734 CTAGGCAAACAGAAAGAACAAGG - Intronic
1000917562 5:167100565-167100587 CTATTAAAGCAAAAAGAACAGGG - Intergenic
1001373953 5:171236653-171236675 CTATGACAATACACAGTACTTGG - Intronic
1002583188 5:180223001-180223023 CTATGAGACCAGAAAGAGCATGG + Intergenic
1003413037 6:5882596-5882618 CTATGAAAGCACCTAGAACATGG - Intergenic
1004381139 6:15133576-15133598 CCATGTCAACAGAAAGAAAAAGG + Intergenic
1005351980 6:24945592-24945614 CAATAACAGCACAAAGAAGAGGG + Intronic
1005610109 6:27515391-27515413 CTATCAAAACACAAAGAAGCAGG - Intergenic
1005771616 6:29078854-29078876 CAATGAGAACACATGGAACAGGG + Intergenic
1006874259 6:37281679-37281701 AGATGACACCACAAAGCACAAGG - Intronic
1008957370 6:57230416-57230438 CTATGTCAAAACAAAGAAAGGGG - Intergenic
1010976976 6:82326145-82326167 CTGTGAGAACAAAGAGAACAGGG - Intergenic
1012382910 6:98641417-98641439 ATATTACAAAACAAACAACAAGG - Intergenic
1014239709 6:119001931-119001953 CTCAGACAAAAAAAAGAACAAGG - Intronic
1016263968 6:142210026-142210048 CTATGATAACCAAAACAACATGG + Intronic
1016487509 6:144558238-144558260 CTCTGAAAACTCAAAGAAGAGGG + Intronic
1016916498 6:149248827-149248849 CTGTGACAAGACAGAGAAAATGG - Intronic
1020492979 7:8811841-8811863 CTATGGCAAAGCAAAGAAGAAGG + Intergenic
1022105815 7:27197128-27197150 CTCTGATAACACAATAAACATGG + Exonic
1022288904 7:28982040-28982062 CTATCAAAACAGGAAGAACATGG + Intergenic
1024070665 7:45782622-45782644 CTATAAGAACAAAAAGAAAAAGG - Intergenic
1024325450 7:48105933-48105955 TTATTATAACACAAAGAATAAGG + Intronic
1024428492 7:49258433-49258455 CAAAGACAAAACAAACAACAAGG + Intergenic
1025009153 7:55381836-55381858 CAGTGACAAGACAAAGGACAGGG + Intronic
1025738048 7:64171122-64171144 CTATGGTAACAAAAACAACATGG - Intronic
1027127763 7:75568998-75569020 CTCTGTCAAAAAAAAGAACAAGG + Intronic
1027680965 7:81221633-81221655 CTATAATAACAAAAATAACATGG - Intergenic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1030857004 7:114571262-114571284 ATATGACAACTTGAAGAACATGG - Intronic
1031137576 7:117901595-117901617 CTGTGACAGCACAAGGAGCAAGG + Intergenic
1031894687 7:127335802-127335824 CTATGACAAGTCAAAGTAGAGGG + Intergenic
1033998045 7:147376555-147376577 TTAAGACAACACAAGGAAAAAGG - Intronic
1034375039 7:150634839-150634861 CAATGAGAACACATGGAACAGGG - Intergenic
1035651101 8:1265879-1265901 CTCATACAACACAAAGCACATGG + Intergenic
1039216571 8:35278413-35278435 TTTTCACAACAAAAAGAACAAGG - Intronic
1039388310 8:37156522-37156544 CTATTAAAACACAGAGAATAGGG + Intergenic
1042498840 8:69486833-69486855 CTAGGGCATCACAATGAACATGG + Intronic
1042770949 8:72381981-72382003 CTAGTACCACACAAAGAAAAGGG - Intergenic
1042919027 8:73903469-73903491 CCATGAAAATACTAAGAACAGGG - Intergenic
1043312204 8:78874800-78874822 CTTTGACATCAATAAGAACAAGG - Intergenic
1043774962 8:84254935-84254957 TTATGACAACACGAACAGCATGG + Intronic
1045197033 8:99943180-99943202 ATATGAAGACACAAAGATCAGGG + Intergenic
1045609225 8:103816015-103816037 CTGTCAGAACAGAAAGAACATGG - Intronic
1047051634 8:121119021-121119043 CTATGACCTCACATAGAAGAAGG - Intergenic
1048679840 8:136828908-136828930 CTATGACAACAGAAAGCACAAGG - Intergenic
1049968272 9:798719-798741 CCAAGGCAACTCAAAGAACAGGG + Intergenic
1052249867 9:26385486-26385508 CAATGACAACACAATAAAAATGG - Intergenic
1052295554 9:26893128-26893150 CTATGACAATAAAGAGAATAGGG + Intergenic
1052583722 9:30395849-30395871 CAATAACAGCACAAAGAAGAGGG - Intergenic
1053691309 9:40588729-40588751 CTATGGCAGGACAAAGACCAGGG - Intergenic
1054273493 9:63048756-63048778 CTATGGCAGGACAAAGACCAGGG + Intergenic
1054302569 9:63389700-63389722 CTATGGCAGGACAAAGACCAGGG - Intergenic
1054401341 9:64716200-64716222 CTATGGCAGGACAAAGACCAGGG - Intergenic
1054434949 9:65200520-65200542 CTATGGCAGGACAAAGACCAGGG - Intergenic
1054495440 9:65821161-65821183 CTATGGCAGGACAAAGACCAGGG + Intergenic
1057346408 9:94254831-94254853 CTATGATAACAGAAAGGCCAGGG - Intergenic
1057358087 9:94348394-94348416 GTATGAAAACACAAAGTATAGGG + Intergenic
1057649662 9:96909223-96909245 GTATGAAAACACAAAGTATAGGG - Intronic
1057712929 9:97463526-97463548 CTGGAACAATACAAAGAACAAGG + Intronic
1057805017 9:98213571-98213593 GTGTGACAACACTAAGTACAGGG + Intronic
1058077532 9:100666677-100666699 CTATAGTAACACAAACAACATGG + Intergenic
1061534889 9:131241454-131241476 CTATGACAAGAAAAAGCAGAGGG + Intergenic
1203439183 Un_GL000195v1:172468-172490 CTTTGAGAACACAAAGAATGGGG - Intergenic
1203621987 Un_KI270749v1:134920-134942 CTATGGCAGGACAAAGACCAGGG - Intergenic
1185939661 X:4301792-4301814 ATATTACAACTCATAGAACAAGG + Intergenic
1186160222 X:6769587-6769609 CCATGACAACACAAACAAGAAGG - Intergenic
1187128820 X:16481211-16481233 CCATGGAAACACAAAGAAAAAGG - Intergenic
1187138386 X:16570306-16570328 CAATGACAACAACAAAAACAAGG - Intergenic
1187625517 X:21108461-21108483 CAATGACAAGACAAAGAAAAAGG - Intergenic
1187878673 X:23826071-23826093 CTATGGGAACACTAAGAAGAAGG + Intergenic
1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG + Intergenic
1189427107 X:40911454-40911476 CTAGAACAAAATAAAGAACAAGG + Intergenic
1191084618 X:56551005-56551027 GTATGACAACACAGAAAGCAAGG - Intergenic
1194177503 X:90668387-90668409 ATATGACAACTAAAAGAACTAGG + Intergenic
1198504754 X:137290430-137290452 CTGTGACATCACATAGAACCAGG + Intergenic
1198893902 X:141429787-141429809 CTATGACAGCTCACAGAACTTGG + Intergenic
1199397471 X:147356235-147356257 CTATGGTAACCAAAAGAACATGG + Intergenic
1200524173 Y:4250533-4250555 ATATGACAACTAAAAGAACTAGG + Intergenic
1200926912 Y:8662915-8662937 CCATGAAAACGTAAAGAACATGG - Intergenic
1201189996 Y:11437390-11437412 CTATGGCAGGACAAAGACCAGGG - Intergenic
1201412998 Y:13720063-13720085 CAAAGACAACACAAAGCACAGGG - Intergenic
1201541136 Y:15106109-15106131 CAATGACAAAACAAACAAAATGG - Intergenic
1201617201 Y:15913776-15913798 CTGTTACATCACAAAGAACTTGG - Intergenic
1202341808 Y:23877384-23877406 CTTTGAAAACACAAAACACAAGG - Intergenic
1202528959 Y:25792702-25792724 CTTTGAAAACACAAAACACAAGG + Intergenic
1202583633 Y:26404537-26404559 CTATGGCAGGACAAAGACCAGGG + Intergenic