ID: 1030567885

View in Genome Browser
Species Human (GRCh38)
Location 7:111183402-111183424
Sequence CTCTGACTAATTATGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030567881_1030567885 12 Left 1030567881 7:111183367-111183389 CCATAAAGATCAAACTAATTAAG 0: 1
1: 0
2: 3
3: 17
4: 280
Right 1030567885 7:111183402-111183424 CTCTGACTAATTATGGAAATTGG 0: 1
1: 0
2: 2
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030567885 Original CRISPR CTCTGACTAATTATGGAAAT TGG Intronic
902922006 1:19671796-19671818 ATATGTCTATTTATGGAAATGGG + Intronic
905076036 1:35270939-35270961 CTATGACTAATTATTGCATTAGG - Intronic
909550936 1:76897736-76897758 CTCTGCCTAATAAGGGAACTGGG + Intronic
909836232 1:80258958-80258980 ATATGACTAAGTCTGGAAATGGG - Intergenic
911323771 1:96445194-96445216 CTCTTACTAACTTTGGAGATAGG - Intergenic
911454339 1:98104409-98104431 TTCTGACTAATCCTAGAAATAGG - Intergenic
911664998 1:100541849-100541871 ATCTGAATAATTATGGAAGTTGG + Exonic
917452050 1:175155518-175155540 CTCTCACTAGTTATGTAATTTGG - Intergenic
919313277 1:195939218-195939240 CTCTGACTAGTTATTTAAAATGG - Intergenic
923842700 1:237690865-237690887 TTCTGATTCATTCTGGAAATGGG - Intronic
923995809 1:239492845-239492867 CTCTGAGTACTGATGAAAATTGG - Intronic
1064117152 10:12588113-12588135 GGCTCAGTAATTATGGAAATTGG + Intronic
1068991405 10:63154851-63154873 CCCTGATTAATTATGTAAACTGG - Exonic
1069914334 10:71778109-71778131 CTCTGACCAATTTGGGAAGTAGG - Intronic
1072306888 10:94116328-94116350 CTCTGACTGATTTTGGAAATGGG + Intronic
1074082915 10:110181921-110181943 CACTGACTAGCTATGGAATTCGG + Intergenic
1074551705 10:114449232-114449254 TTCTGGCTAATTTTGCAAATCGG + Intronic
1074740874 10:116483394-116483416 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1077612279 11:3650683-3650705 CTCTGCCTAATAAGGGAACTGGG - Intronic
1077968904 11:7166747-7166769 TTTTCACTAATTATGGGAATGGG - Intergenic
1077979326 11:7284354-7284376 CTCCAACTAATTAAGGAAAAAGG - Intronic
1080681191 11:34477677-34477699 CTGTGACAAATTATCAAAATTGG - Intergenic
1083015644 11:59450449-59450471 AGCTGACTTATTATGGAAAAGGG - Intergenic
1083061927 11:59882078-59882100 GTATGACTTATTATGGATATAGG + Intergenic
1087726557 11:101724219-101724241 ATCTGCCTAAATATTGAAATTGG + Intronic
1088223991 11:107599009-107599031 CTCTGAGTATTTATGGAATAAGG + Intronic
1089861688 11:121595764-121595786 CTCTGACTACTCACGGCAATTGG - Exonic
1090514067 11:127406054-127406076 CTCTAACTATTGATGGAATTGGG - Intergenic
1095380738 12:41588340-41588362 ATCTGAAGAAATATGGAAATTGG - Intergenic
1101048797 12:100839041-100839063 TTCTAACTAATAATGAAAATAGG - Intronic
1101358853 12:104007638-104007660 CTATGTCTATTTATGGAATTAGG + Intronic
1102638003 12:114341327-114341349 CTCAAATTATTTATGGAAATAGG + Intergenic
1106967437 13:35088423-35088445 CTATGGCTAACCATGGAAATTGG - Intronic
1108871570 13:54993348-54993370 CTTTGAATAAACATGGAAATTGG + Intergenic
1110035842 13:70682401-70682423 CTCTGAGTGATTTTTGAAATGGG - Intergenic
1110462392 13:75759478-75759500 ATTTGACTTATTATGGAAAAAGG - Intronic
1117095724 14:52295482-52295504 CTGTCAATAATTATGGAAATGGG + Intergenic
1117516214 14:56504286-56504308 CTCTAGTTAATTATTGAAATTGG - Intronic
1117966365 14:61210669-61210691 CACTGACTCATTATGGGACTTGG - Intronic
1120817659 14:88880476-88880498 TTCTGACTAATAAGGGAAAGTGG + Intronic
1121225365 14:92317959-92317981 CTCTGACTCCTCATGCAAATTGG + Intergenic
1121289516 14:92762614-92762636 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1121798300 14:96753737-96753759 CTGTGACCAAATTTGGAAATAGG - Intergenic
1128530093 15:68439212-68439234 CTCTGAAAAATAATGGAAAATGG - Intergenic
1134275165 16:12769551-12769573 ATATGACTAATTAGGGAACTGGG - Intronic
1135461623 16:22648947-22648969 CTCTGGATAATTTTGGAAAGGGG - Intergenic
1140558551 16:75949495-75949517 CTCTGACTGCTTCTGGAAACAGG + Intergenic
1147638933 17:41982083-41982105 TTCTGTCTAATTTTGGAATTTGG + Intronic
1149041071 17:52188701-52188723 TTATGACTAATTATGTAATTGGG + Intergenic
1154482133 18:14841070-14841092 CTCTGCCAAATTTTGGTAATGGG - Intronic
1155179420 18:23331149-23331171 CTGTGACTAATTATGGAAAACGG - Intronic
1155554819 18:27007217-27007239 CTCTCACTGACTATGGAAACAGG - Intronic
1156301832 18:35843253-35843275 CCCTGATTAATTATGTAAACTGG - Intergenic
1156945380 18:42823163-42823185 TTCTGACTAAAAATGAAAATGGG - Intronic
1157317930 18:46608847-46608869 TTCAGACTAATTATGAAAACAGG + Intronic
1158676203 18:59520736-59520758 CTCAAAATCATTATGGAAATTGG - Intronic
1159172341 18:64787485-64787507 CTCTGAGTAATAATGGCACTTGG + Intergenic
1159933452 18:74338552-74338574 CTTTGACTACTTATGTAAAGTGG + Intronic
1164404442 19:27931048-27931070 CTCTGACTTATGATGGGGATGGG + Intergenic
1164795909 19:31029667-31029689 TTCTGACTACTTCTAGAAATGGG + Intergenic
1165835448 19:38752359-38752381 CTCGGCCTAATTAGGGAACTGGG - Intronic
1166038016 19:40183318-40183340 CTCTGACTGTATTTGGAAATAGG - Intergenic
1166968893 19:46548787-46548809 CTCGCACTAAATATGGGAATAGG + Intronic
1167580660 19:50340116-50340138 CTGTGCCTAATTTTGGAAACTGG + Intronic
926372628 2:12195574-12195596 CTCATACTAATTCTGAAAATGGG + Intergenic
929391445 2:41472834-41472856 CTCTGACTCTTTATGGGATTGGG + Intergenic
930283772 2:49402772-49402794 CTTTGCCTAATTAAGAAAATAGG + Intergenic
933017444 2:77146622-77146644 CTGTGACTTTTAATGGAAATAGG - Intronic
933135943 2:78735690-78735712 CTCTGACACATAATGCAAATTGG + Intergenic
941148517 2:161884522-161884544 CTCTCACTAATCAAAGAAATAGG - Intronic
941901290 2:170681364-170681386 TTTAGACTAATTATGTAAATTGG - Intergenic
943879684 2:193125479-193125501 ATTTGACTGATTATTGAAATGGG + Intergenic
944425252 2:199575103-199575125 CTCTGACTACCTTTGGGAATGGG + Intergenic
944719510 2:202408996-202409018 CTTTGGCTAATTATGGGACTAGG - Intronic
945105480 2:206309061-206309083 CTTTGACTGATCCTGGAAATTGG - Exonic
945334428 2:208575063-208575085 CTCTGTCTAATGATGGAAACGGG - Intronic
945646296 2:212499481-212499503 CTCTAAATAATTATTTAAATAGG - Intronic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
1170658519 20:18314381-18314403 TTTACACTAATTATGGAAATAGG + Intronic
1177166117 21:17605760-17605782 TTCTGATTAAGTAGGGAAATAGG + Intronic
1177616735 21:23532295-23532317 CACTGACAATTTATGAAAATTGG - Intergenic
1181687078 22:24536799-24536821 CTGTGACTAATTTTGCTAATTGG - Intergenic
1181742616 22:24933445-24933467 CTCTAACTGGTTACGGAAATAGG - Intergenic
953728584 3:45424698-45424720 CTCTGACGAAAAATGGAAAATGG - Intronic
960223429 3:115144313-115144335 GTCTGAATAATTAGGTAAATTGG - Intronic
962319263 3:134377258-134377280 CTCTGACAGGTTATGGAAACAGG + Intergenic
964824055 3:160806064-160806086 CTCAGACTAGTAATGCAAATGGG - Intronic
965484035 3:169256807-169256829 ATCTGAAAAATCATGGAAATGGG - Intronic
965836892 3:172862757-172862779 ATCTGACTATATTTGGAAATGGG + Intergenic
967947433 3:194815070-194815092 CTTTGACTATTTATGAAATTGGG - Intergenic
968979673 4:3840116-3840138 CTCTGACCACTAATGGAATTTGG + Intergenic
972118377 4:35667702-35667724 CTATGTCTAAATATGGAAAAAGG + Intergenic
972146157 4:36028730-36028752 CTCTTACTAATTTTGAAATTTGG + Intronic
972551611 4:40140420-40140442 CTGTGAGTCATTATGGTAATAGG + Intronic
972590923 4:40486297-40486319 CTCTGGCATATTAAGGAAATTGG - Intronic
976865872 4:89725807-89725829 CTGTGATTAATTATTGAAAGTGG - Exonic
977800513 4:101224699-101224721 TTCTGAATAAATAAGGAAATCGG + Intronic
979368566 4:119855396-119855418 CTTTTAATAATTAAGGAAATGGG - Intergenic
980537989 4:134154212-134154234 GTCTGCCTAAATATGGATATAGG - Intergenic
981525298 4:145701834-145701856 CTCGGCCTAATAATGGAACTGGG - Intronic
987219706 5:15778026-15778048 TTCTGACTAATTTTGAATATAGG - Intronic
987792392 5:22584758-22584780 CTCTTACTATCTATTGAAATAGG + Intronic
987954689 5:24723327-24723349 CTCACACTAATAATGGAAATAGG + Intergenic
988325002 5:29753364-29753386 CTTTGACTAATTATGCTAAGTGG + Intergenic
988820245 5:34876740-34876762 CTTTGTCTAATTTTGGAATTAGG - Intronic
988893054 5:35640180-35640202 CTTTGACAAAATTTGGAAATGGG + Intronic
989120534 5:38000163-38000185 CTCTGGCTGTTTATGGAAAAAGG + Intergenic
990707298 5:58543681-58543703 CTCTGAGACATTCTGGAAATGGG - Intronic
991295309 5:65074151-65074173 CACTGACTGAGTATGAAAATAGG - Intergenic
992172006 5:74112202-74112224 CTCTGACTGATTTAGGAAAAGGG + Intergenic
992232961 5:74681612-74681634 CTCTGACTCATTATTTAAAAGGG - Intronic
993075112 5:83219728-83219750 CTATGACTAAGTATGAAAAAAGG + Intronic
993929209 5:93917277-93917299 CTCTGACTAACTCTGTAAAGGGG + Intronic
993955128 5:94223282-94223304 CCCTGACTAACTATGCAACTTGG - Intronic
995967052 5:117920105-117920127 GTATGATTAATTTTGGAAATGGG + Intergenic
997770542 5:136549293-136549315 CTCAGACTAATAAGGGAACTGGG + Intergenic
998857581 5:146408398-146408420 CTCTGACAAATTAGTGAAAAAGG - Intergenic
999974234 5:156895152-156895174 CCATGAATATTTATGGAAATTGG - Intergenic
1000203433 5:159034442-159034464 CAGTGAGCAATTATGGAAATTGG + Intronic
1001344877 5:170885277-170885299 CTCTGACTAATCTTTGAGATTGG + Intronic
1003689916 6:8343553-8343575 CTTTGACTAAATATTCAAATTGG + Intergenic
1005480933 6:26254695-26254717 CTATGACTGATTATGAATATAGG - Intergenic
1005662920 6:28018693-28018715 CTCTGACTAGTTAAGGAATAGGG - Intergenic
1007962870 6:45976751-45976773 CTCTGTCTAAATATTCAAATGGG + Intronic
1008850121 6:56013784-56013806 CTCAGCCTAATAAGGGAAATGGG + Intergenic
1010355635 6:74929413-74929435 CACTGACTTATTAAGGAAATAGG - Intergenic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1019332715 7:468594-468616 ATCTCACTAATTAAGGAAATAGG - Intergenic
1020659895 7:10969684-10969706 CTTAGAGTAATTTTGGAAATAGG + Intergenic
1021172022 7:17409780-17409802 CTCTGACAAATTAAGAAAAAAGG + Intergenic
1021474350 7:21043814-21043836 CTCTGACTTACTGTGGAACTAGG - Intergenic
1022010501 7:26304421-26304443 CTCTGTCTGCTTCTGGAAATTGG - Intronic
1026117042 7:67504494-67504516 CACTGACTCATTAGGCAAATGGG - Intergenic
1030193571 7:106832386-106832408 CTCTGCCTAATAAGGGAATTGGG - Intergenic
1030567885 7:111183402-111183424 CTCTGACTAATTATGGAAATTGG + Intronic
1033633077 7:143180705-143180727 CTCTGACCCATTAAGGACATAGG - Intergenic
1033957241 7:146866028-146866050 CTCTGAATAATAACAGAAATGGG - Intronic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1035992847 8:4511257-4511279 CTGGGACTATTTCTGGAAATCGG - Intronic
1036672745 8:10803510-10803532 CACTGACTTATTGTAGAAATTGG + Intronic
1036966641 8:13306149-13306171 CTCTTACTATTTATTAAAATGGG + Intronic
1039070945 8:33648812-33648834 CTCTGACAAATTCTGGAAGGAGG - Intergenic
1041401803 8:57453874-57453896 TTCAGAATAATTAGGGAAATTGG + Intergenic
1042740693 8:72041963-72041985 TACTGACTAATTAAGGAAAAAGG + Intronic
1042978056 8:74492883-74492905 CTCTGTCTAAGTATGGGCATGGG - Intergenic
1043538544 8:81232964-81232986 CTCTGACTGAATTTGGAATTTGG - Intergenic
1044233212 8:89802593-89802615 CTCAGAATTATTATGGAAATAGG + Intergenic
1044838777 8:96320232-96320254 CTCTGTCTAATTAGGGTCATTGG + Exonic
1045962530 8:107984594-107984616 CCCTGATTAATTATGTAAACTGG - Intronic
1046740137 8:117819223-117819245 CTATGACTAATTATAAAATTGGG - Intronic
1047225211 8:122950723-122950745 TGCTCACTATTTATGGAAATGGG + Intronic
1047944932 8:129866737-129866759 CTCTGTCCAGTTATGAAAATGGG - Intronic
1049933026 9:474363-474385 CTCTTACTAATTAGTGATATTGG + Intronic
1056314888 9:85378567-85378589 CTCTGACTTAGTAGGCAAATGGG + Intergenic
1057234939 9:93350351-93350373 CTCAGCCTAATAAGGGAAATGGG - Intergenic
1058368566 9:104237167-104237189 ATCTGACTAATTAAGATAATTGG - Intergenic
1059727978 9:117027971-117027993 CACTTACTAATTATGGATCTTGG - Intronic
1059927589 9:119226709-119226731 ATGAGAATAATTATGGAAATCGG + Intronic
1060365547 9:123008773-123008795 CTCTGAGTACTTGTGGAACTTGG + Intronic
1062674850 9:137735878-137735900 CTCTGGCTCATGGTGGAAATTGG - Intronic
1186502347 X:10061638-10061660 CTTTGTCTATTTTTGGAAATAGG + Intronic
1186898129 X:14025669-14025691 CCATGACTAAATAAGGAAATTGG + Intronic
1187111620 X:16307507-16307529 TTGTGACCAATTATAGAAATAGG + Intergenic
1187429226 X:19206462-19206484 CTCTGATTCACTATGGAATTTGG + Intergenic
1189140598 X:38601485-38601507 CAATCAGTAATTATGGAAATTGG + Intronic
1190473130 X:50802436-50802458 CTCTGAGAGATTATGGGAATTGG - Intronic
1190799677 X:53775925-53775947 CTCTGACTAGTAAAGGATATGGG + Intergenic
1196038222 X:111170907-111170929 CTCTGTCTAACTACAGAAATAGG + Intronic
1199198675 X:145061639-145061661 CTGAGACTAATTATGGCAACAGG + Intergenic