ID: 1030568464

View in Genome Browser
Species Human (GRCh38)
Location 7:111190629-111190651
Sequence TCACTAACAATATGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030568463_1030568464 -6 Left 1030568463 7:111190612-111190634 CCATTTACTACAATATGTCACTA 0: 1
1: 0
2: 0
3: 15
4: 202
Right 1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG 0: 1
1: 0
2: 0
3: 15
4: 177
1030568462_1030568464 12 Left 1030568462 7:111190594-111190616 CCACACTTAGGTCGAAATCCATT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG 0: 1
1: 0
2: 0
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030568464 Original CRISPR TCACTAACAATATGTGACCT TGG Intronic
901348830 1:8573471-8573493 TCACTTAAAATAAGTGAACTAGG - Intronic
901713530 1:11134792-11134814 TCACTATCAATATGTTACCCTGG + Intronic
908562470 1:65320470-65320492 TCATTTACAAGCTGTGACCTTGG + Intronic
908907521 1:69033510-69033532 TCACTTACAATATGTGAGTCAGG + Intergenic
909233064 1:73116956-73116978 TCACTTGCAAAACGTGACCTTGG - Intergenic
910264094 1:85320539-85320561 TTACTGACCATATATGACCTTGG - Exonic
911843904 1:102723331-102723353 TTACTAACAAGATCTGAGCTGGG - Intergenic
913309140 1:117468537-117468559 TCACTAGCCACATGTGACCATGG + Intronic
916393679 1:164361493-164361515 TCACTAAGAATCTGTGAACCAGG - Intergenic
919375910 1:196794758-196794780 TCACTAACCATATGCTAACTGGG - Intronic
919385616 1:196919643-196919665 TCACTAACCATATGCTAACTGGG - Intronic
921559854 1:216644086-216644108 TCACTAAAACTCTCTGACCTTGG + Intronic
922002016 1:221488446-221488468 TCAGAAACAATATGTGATCTGGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
922849154 1:228717608-228717630 TCAGTAACAGTATTTCACCTTGG - Intergenic
923188933 1:231601282-231601304 CCACTAAGAATATGTAAACTGGG - Intronic
924306621 1:242696217-242696239 CCACTAACTAGTTGTGACCTTGG + Intergenic
924679193 1:246214232-246214254 TCCCTACCATTTTGTGACCTGGG - Intronic
1064087988 10:12359949-12359971 ACACTAACATCCTGTGACCTGGG - Intronic
1065432008 10:25668276-25668298 TCACTAACAAAGGGTGAGCTTGG - Intergenic
1065495880 10:26327751-26327773 TCCCTAACAATATGTCAACTTGG - Intergenic
1066597970 10:37073647-37073669 TCACTAAGAAGATAAGACCTGGG + Intergenic
1067428346 10:46226062-46226084 TCACTAATATTTTGTGACCTTGG - Intergenic
1068065817 10:52129987-52130009 TCACTAGCTATATCTGACTTTGG + Intronic
1069135794 10:64763662-64763684 TGACTAACAATAAAAGACCTAGG + Intergenic
1071117476 10:82238870-82238892 GCACTAAAAATAAGTGACATAGG - Intronic
1071751610 10:88483964-88483986 TAACTAACACTATGTTATCTTGG - Intronic
1072038994 10:91590105-91590127 TCTCTGCCATTATGTGACCTTGG - Intergenic
1073203245 10:101753264-101753286 TTACTAACCAGCTGTGACCTTGG - Intergenic
1073834820 10:107429247-107429269 TCATTAAAGATGTGTGACCTTGG - Intergenic
1076024801 10:127102506-127102528 TGACTAAGAATATATTACCTGGG - Intronic
1078602798 11:12748610-12748632 TCGCTAAAAATATGTCTCCTGGG + Intronic
1078647432 11:13154196-13154218 TCAGTAACTATATATGAACTTGG + Intergenic
1081518574 11:43859400-43859422 TCTCAAACAATATATGACATAGG - Intergenic
1081703608 11:45167344-45167366 GCACCTACACTATGTGACCTAGG - Intronic
1085899430 11:80680539-80680561 TGACTAATAATATTTGAACTTGG - Intergenic
1087416123 11:97858058-97858080 TCTCTAGCAAAATGTGCCCTGGG - Intergenic
1088812602 11:113401651-113401673 ACACTAACTTTATGTGACCAGGG + Intergenic
1091231909 11:133993541-133993563 TCACTAACCAGCTGTGACCAAGG + Intergenic
1092174301 12:6392444-6392466 TCACCAACAAAATGTGAACTTGG - Intergenic
1093110268 12:15143847-15143869 TCACTAACAAGATGTCATCTAGG + Intronic
1094588616 12:31800382-31800404 TTACTAACAATTAGTGATCTAGG - Intergenic
1095248487 12:39950384-39950406 AATCTAACAATATGTGCCCTGGG + Intronic
1096518667 12:52172044-52172066 TCACTTACAAACTGGGACCTTGG - Intronic
1097668311 12:62506917-62506939 TCACTGACAATATAAGGCCTAGG - Intronic
1098068627 12:66647678-66647700 TCTCTAAGAATATGTGATGTTGG - Intronic
1098512396 12:71332179-71332201 TCACAAACAATAAGTGACTGAGG + Intronic
1100279156 12:93101638-93101660 CCACTAACCAGCTGTGACCTCGG - Intergenic
1103313346 12:120030599-120030621 TCAATAATGTTATGTGACCTTGG - Intronic
1105267351 13:18833472-18833494 TCTCTTACAATATGTACCCTTGG - Intergenic
1108128766 13:47274238-47274260 TCACTGACAATATATGAAATGGG + Intergenic
1108539425 13:51424978-51425000 TCACTAAAAATATTTGCCTTAGG - Intronic
1112346392 13:98593479-98593501 GCACTATCAAAATGTGAGCTGGG - Intergenic
1112642249 13:101289053-101289075 TCACTAAAAAGTTGTGGCCTGGG + Intronic
1113138597 13:107121360-107121382 TCTCTAACATTATTTTACCTTGG - Intergenic
1114034060 14:18604992-18605014 TCACTTACTATGGGTGACCTTGG - Intergenic
1114078856 14:19184166-19184188 TCACTTACTATGGGTGACCTTGG - Intergenic
1114124585 14:19710018-19710040 TCACTTACTATGGGTGACCTTGG + Intergenic
1114333375 14:21660563-21660585 TCACTTACAATGTGTGAACAGGG + Intergenic
1116428167 14:44815611-44815633 TAACTAACTATATATTACCTTGG + Intergenic
1118928432 14:70215815-70215837 CTACTAACTATATGTCACCTTGG + Intergenic
1119625655 14:76172647-76172669 TCACTTACGATATGTGACATTGG + Intronic
1123510814 15:20997543-20997565 TCACTTACTATGGGTGACCTTGG + Intergenic
1123568034 15:21571300-21571322 TCACTTACTATGGGTGACCTTGG + Intergenic
1123604142 15:22006624-22006646 TCACTTACTATGGGTGACCTTGG + Intergenic
1126199798 15:45972960-45972982 TAACTATTGATATGTGACCTTGG + Intergenic
1126750552 15:51872566-51872588 TCACAAAAAATATATGACATAGG - Intronic
1127483378 15:59397598-59397620 TCATAAACAATATTTGACCTTGG + Intronic
1127636406 15:60874829-60874851 TCACTAACTATAGGTGATTTGGG + Intronic
1129278116 15:74460981-74461003 TTACTAGCGATCTGTGACCTTGG - Exonic
1131334487 15:91534820-91534842 TGACTAGCAATCTGTGAACTTGG + Intergenic
1132333547 15:101028851-101028873 TCAGGAATAATTTGTGACCTGGG + Intronic
1202976393 15_KI270727v1_random:298390-298412 TCACTTACTATGGGTGACCTTGG + Intergenic
1133382176 16:5340470-5340492 TCACTCCCAATATGTGCCCATGG - Intergenic
1133622456 16:7539492-7539514 TCATGGACAATATGTCACCTGGG - Intronic
1134809252 16:17153288-17153310 CCACTCACAGTGTGTGACCTTGG - Intronic
1137757808 16:50916618-50916640 TCACTATTAATATTTTACCTTGG - Intergenic
1138150343 16:54650761-54650783 TCACTGTCAATCCGTGACCTTGG + Intergenic
1140263326 16:73399298-73399320 TCACAAACGATATGGGAACTTGG + Intergenic
1151097539 17:71515893-71515915 TCACTAACAATTTGTAATCAAGG + Intergenic
1151289518 17:73139445-73139467 TCACTAAGAAAATGTGCCCTAGG - Intergenic
1152489489 17:80620150-80620172 TCACTAACAATGCATGGCCTTGG - Intronic
1154421060 18:14227963-14227985 TCTCTTACAATATGTACCCTTGG + Intergenic
1156050165 18:32923010-32923032 TCTCATAGAATATGTGACCTAGG + Intergenic
1156266481 18:35493072-35493094 ACACTAACACTGTGTGAGCTTGG + Intronic
1163923430 19:20315219-20315241 TCACAAAGAAGATTTGACCTGGG - Intergenic
1167850760 19:52199773-52199795 ACACTAACAATCACTGACCTGGG - Intronic
1202641276 1_KI270706v1_random:89740-89762 TCTCTTACAATATGTACCCTTGG - Intergenic
925654459 2:6130784-6130806 TCATTAACAATTTGTAAACTAGG + Intergenic
926760505 2:16274475-16274497 TCACTAACTACATGTGGCTTTGG + Intergenic
928248521 2:29653439-29653461 TCACTGAGAAACTGTGACCTAGG + Intronic
928985371 2:37176044-37176066 CCACTAACCATATGTGACAACGG - Intronic
930019539 2:46993147-46993169 TCTCAAACAAGGTGTGACCTTGG - Intronic
931633007 2:64318010-64318032 TCACTTAAATTATGTTACCTTGG + Intergenic
934053592 2:88232584-88232606 TTGCTAAAAATATGTGACTTAGG + Intergenic
934497089 2:94813170-94813192 TCTCTTACAATATGTACCCTTGG - Intergenic
939556674 2:143683053-143683075 TAAATAACAATATGTCACTTAGG - Intronic
942375227 2:175329677-175329699 TCACTAATAAGTTGTGACTTTGG - Intergenic
942565005 2:177257430-177257452 TCACTAAATATATATAACCTGGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946897820 2:224342595-224342617 TAAATAACAATGTGTGGCCTGGG + Intergenic
947398514 2:229710694-229710716 GCAGTATCAAAATGTGACCTTGG + Intronic
1169556427 20:6755585-6755607 TCACTTAAAATATATGACCGAGG + Intergenic
1171888386 20:30679951-30679973 TCTCTTACAATATGTACCCTTGG - Intergenic
1174455783 20:50647785-50647807 TCATTCTCACTATGTGACCTTGG + Intronic
1176852412 21:13932003-13932025 TCTCTTACAATATGTACCCTTGG - Intergenic
1176924174 21:14726657-14726679 CCACAAACAATCTTTGACCTAGG - Intergenic
1180360685 22:11892135-11892157 TCTCTTACAATATGTACCCTTGG + Intergenic
1180458177 22:15532035-15532057 TCACTTACTATGGGTGACCTTGG - Intergenic
1181186203 22:21106262-21106284 TCACTAACAATGAGTAACCAAGG - Intergenic
1182478130 22:30587948-30587970 CCACTAACTAACTGTGACCTTGG - Intronic
949714511 3:6913847-6913869 TGACCAACAATCTGTGACCTTGG + Intronic
950108264 3:10402083-10402105 ACACTTACCATATTTGACCTGGG + Exonic
950327392 3:12124273-12124295 TGCCTAATAATATGTGACATAGG + Intronic
950333043 3:12172160-12172182 GCTATAACATTATGTGACCTTGG + Intronic
951223910 3:20098369-20098391 TCACTTACTAAATGTGACTTTGG + Intronic
955457073 3:59134816-59134838 CCTCTAACAATGTATGACCTTGG - Intergenic
955655047 3:61236547-61236569 TCTCCAACATTCTGTGACCTGGG - Intronic
957221923 3:77393727-77393749 TGACTAATAATATATGACTTGGG - Intronic
960394841 3:117123928-117123950 TTACTAGCAATATTTGATCTTGG - Intronic
962863662 3:139428236-139428258 TTACTAGAACTATGTGACCTTGG + Intergenic
967123744 3:186406608-186406630 TTTCTAACAACATGTGACCTGGG + Intergenic
971140459 4:23919740-23919762 TCAATAACAATATTTTATCTAGG - Intergenic
972302926 4:37802432-37802454 TTACTAAAATTGTGTGACCTGGG + Intergenic
973384788 4:49500271-49500293 TCTCTTACAATATGTACCCTTGG - Intergenic
974570959 4:63648472-63648494 TCACTAAAAATATGGGCCCGGGG - Intergenic
975734916 4:77371747-77371769 TCACCAACAAGAAGTGAGCTTGG + Intronic
978086184 4:104657949-104657971 GCACTAAAAATATGTTAACTGGG + Intergenic
979825494 4:125228248-125228270 TCACTAACATTTTGGGACTTAGG + Intergenic
980581804 4:134763882-134763904 TCACTAGCAATTTGTGACAATGG + Intergenic
981330903 4:143508626-143508648 TCAGTAACAAAATGTTACCAGGG - Intergenic
982277541 4:153651878-153651900 TCACTTACAAGCTGTGACATAGG - Intergenic
983695301 4:170521012-170521034 TCATTAAGAATATTTGACTTTGG - Intergenic
984489141 4:180410188-180410210 TCCCTAACACTATGTGATCTGGG + Intergenic
984596612 4:181676254-181676276 TCACAAACAATATATAACATGGG + Intergenic
1202768644 4_GL000008v2_random:175599-175621 TCTCTTACAATATGTACCCTTGG - Intergenic
986846404 5:11760726-11760748 TCACTAACTGTATAGGACCTAGG - Intronic
991644285 5:68786153-68786175 CCACTAATAGTTTGTGACCTCGG - Intergenic
992119014 5:73571906-73571928 TCACTAGCTAATTGTGACCTCGG + Intronic
992153669 5:73932493-73932515 CCACTAGCATTATTTGACCTTGG - Intronic
999486837 5:152005176-152005198 TCAATCACAATGTGAGACCTTGG - Intergenic
1000592320 5:163173300-163173322 TTGCTAACATTTTGTGACCTGGG - Intergenic
1002960668 6:1912063-1912085 TCACTAAAAATAAGTGATCTTGG + Intronic
1004919509 6:20363203-20363225 TCAATAATAATATGTCACTTTGG + Intergenic
1005687689 6:28271040-28271062 TCACTTACATGTTGTGACCTGGG - Intronic
1009733494 6:67642307-67642329 TTACTACCAATAGGTGACTTTGG + Intergenic
1011981289 6:93382307-93382329 TCATTAAAAGTATGTAACCTAGG + Intronic
1013504236 6:110783340-110783362 ACACTAAGAATATCTGAGCTGGG + Intronic
1013941064 6:115663208-115663230 TAACTAGCAGTATGTGACCTTGG - Intergenic
1015339431 6:132080830-132080852 ACACTAATAATATGTGTACTAGG - Intergenic
1015436234 6:133192459-133192481 TCACAAACACTCTGTGAGCTGGG - Intergenic
1015436827 6:133199419-133199441 TCAATAACAATATGTGGCAAAGG - Intergenic
1016131612 6:140479633-140479655 TTAAGAACAATATGTGAACTTGG + Intergenic
1017537943 6:155368649-155368671 TCACCAACAATATGTCACAAAGG - Intergenic
1017733473 6:157338977-157338999 TCCCTAACAATATGTTTCTTTGG - Intergenic
1018659293 6:166070537-166070559 TCACTTACCATATGTAACCTAGG - Intergenic
1022641437 7:32188537-32188559 TAAATAAAAATATGTGACATAGG - Intronic
1027523643 7:79240407-79240429 TCACTAACAGGAGGTGACATAGG - Intronic
1028214219 7:88112151-88112173 TTACTGACAATATGTGCCCAAGG - Intronic
1029323879 7:99789015-99789037 TCACTAACTCTGTGTGGCCTTGG - Intergenic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1031342075 7:120615113-120615135 TCAGTAACAATATGAGGGCTCGG + Intronic
1031978741 7:128110515-128110537 TCGCTAACAAAATGAGTCCTAGG - Intergenic
1032761667 7:134948982-134949004 TCACTAACAAGCTGGGGCCTTGG + Intronic
1039875717 8:41583652-41583674 CCACTAACCACGTGTGACCTTGG - Intronic
1041536191 8:58927867-58927889 TCACTATCCACATGTGACCGTGG - Intronic
1041873349 8:62660207-62660229 GCACTAACGATGAGTGACCTTGG + Intronic
1043193885 8:77265186-77265208 TTGCTAAAAATATGTGACCAAGG + Intergenic
1045297368 8:100883776-100883798 TATTTAACAGTATGTGACCTTGG - Intergenic
1048974611 8:139664165-139664187 TGTCTGACATTATGTGACCTTGG + Intronic
1050990389 9:12143761-12143783 TCACTAACTATATATGAGTTAGG - Intergenic
1052494063 9:29204453-29204475 CCACAGACAATATGTGACCCAGG + Intergenic
1053660061 9:40267303-40267325 TCTCTTACAATATGTACCCTTGG + Intronic
1053910435 9:42896654-42896676 TCTCTTACAATATGTACCCTTGG + Intergenic
1054372192 9:64413603-64413625 TCTCTTACAATATGTACCCTTGG + Intergenic
1054524537 9:66108914-66108936 TCTCTTACAATATGTACCCTTGG - Intronic
1054679812 9:67903304-67903326 TCTCTTACAATATGTACCCTTGG + Intergenic
1055850042 9:80615943-80615965 TTACTGAAAATATGGGACCTGGG - Intergenic
1056299759 9:85228949-85228971 TGACCTGCAATATGTGACCTGGG + Intergenic
1058950800 9:109902148-109902170 TCATTAACTACATGGGACCTTGG + Intronic
1059899416 9:118906482-118906504 TTACTAACTATGTGTGATCTTGG - Intergenic
1186321467 X:8430602-8430624 TCACAAACATTATGTTATCTTGG + Intergenic
1186620627 X:11236537-11236559 TCTCTAACTCTATGTTACCTTGG - Intronic
1186624122 X:11274002-11274024 CCACTTGCAATATGTGTCCTGGG - Intronic
1189624817 X:42885404-42885426 TCACTGATAATATGTGGCTTTGG - Intergenic
1190153980 X:47972974-47972996 TCACTAACTATATGGTACCAAGG + Intronic
1193197528 X:78651367-78651389 TGACTAACAAGATCTCACCTCGG - Intergenic
1194678218 X:96818523-96818545 TAAGTAGCCATATGTGACCTGGG - Intronic
1195726576 X:107923821-107923843 TCACTGACTATCTGTGGCCTTGG + Intronic
1196065246 X:111457139-111457161 TTATTAATAACATGTGACCTAGG + Intergenic
1196319896 X:114273966-114273988 TCACTAACAATAAGATATCTAGG + Intergenic
1196677326 X:118433547-118433569 CCCCTTACATTATGTGACCTTGG + Intronic
1199091338 X:143696593-143696615 TCACTTACTAGCTGTGACCTTGG - Intergenic