ID: 1030571597

View in Genome Browser
Species Human (GRCh38)
Location 7:111232495-111232517
Sequence GAGGTTAGCTAGATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030571593_1030571597 5 Left 1030571593 7:111232467-111232489 CCACAGATGGACTGCAAAGGCCA 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1030571597 7:111232495-111232517 GAGGTTAGCTAGATCTGACATGG 0: 1
1: 0
2: 0
3: 4
4: 66
1030571590_1030571597 30 Left 1030571590 7:111232442-111232464 CCAACTCTGTAACACAACACAGA 0: 1
1: 0
2: 1
3: 8
4: 223
Right 1030571597 7:111232495-111232517 GAGGTTAGCTAGATCTGACATGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030571597 Original CRISPR GAGGTTAGCTAGATCTGACA TGG Intronic
906110728 1:43320269-43320291 GAGGTTAGCTAGATTGCCCAAGG - Intronic
906319770 1:44808735-44808757 GAGGTTAGCAAGGCCTGAGAGGG - Exonic
917791331 1:178501063-178501085 GAGGTCAGCCAGCTCTGCCATGG + Intergenic
922165762 1:223114579-223114601 GAGGTGGGCTAGCTCTGACGAGG + Intronic
922330279 1:224568835-224568857 GAGAATAGCTACATCTGAGAAGG - Intronic
923007528 1:230063507-230063529 AAGAATAGCTAGATGTGACATGG - Intronic
1064947816 10:20811676-20811698 GAGATAAGCTAAATTTGACAGGG - Intronic
1066427214 10:35318465-35318487 CAGTTTTGCTGGATCTGACATGG + Intronic
1069484346 10:68811866-68811888 GATGTTAGAATGATCTGACAAGG - Intergenic
1070633325 10:78104180-78104202 GAGTTGAGCAAGATCTCACAGGG - Intergenic
1070789370 10:79180405-79180427 CAGGGAAGCTAGCTCTGACAGGG - Intronic
1071197962 10:83183637-83183659 GACCTTAGCATGATCTGACAGGG + Intergenic
1078803580 11:14672336-14672358 AAGGTAAGCTAGATTTGAGATGG + Intronic
1080375352 11:31703340-31703362 GAGGTGATCTAAATCTGAAAAGG - Intronic
1081590423 11:44419093-44419115 GAGGGTAGATGGCTCTGACAGGG + Intergenic
1084482866 11:69432185-69432207 TAGGATAACTGGATCTGACATGG + Intergenic
1088479587 11:110282550-110282572 GAGTTTAGCTAGGTCAGTCATGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091889958 12:4045413-4045435 GTTGTTAGCTTGATCTGAGAAGG - Intergenic
1103246929 12:119465691-119465713 GAGGTTAGTGTGAGCTGACACGG + Intronic
1104166206 12:126232125-126232147 GAGGCTAGCTAGACCTCACAGGG + Intergenic
1104525214 12:129514530-129514552 GAGGTTAGCATGATCAGAGATGG - Intronic
1108584331 13:51856003-51856025 GAGGTCAGCTATATGTGAGATGG + Intergenic
1110016264 13:70408655-70408677 CAGGTTAGCTAGTTATGACAAGG - Intergenic
1118238128 14:64029476-64029498 GAGGTTAGTTTGATCTCATATGG + Intronic
1122726789 14:103760775-103760797 GAGGCTAGCTAGACCTGAGGCGG - Intronic
1127648936 15:60987412-60987434 GAGGTTGACCAGATCTGAGATGG + Intronic
1131497078 15:92921828-92921850 GAGGTGAGCTAGGACTGAAATGG + Intronic
1131563299 15:93462867-93462889 GTTGTTAGCTGGATCTGCCAAGG - Intergenic
1137439548 16:48486243-48486265 GAGGATAGCTTGAGCTGAGAAGG - Intergenic
1140115338 16:72036741-72036763 GAGGTTAGGTAAATCTTACAAGG - Intergenic
1141299558 16:82801312-82801334 GAGGTTAGATAGATCTTCAAAGG - Intronic
1154094491 18:11399289-11399311 GAGGTCAGGGAGATCAGACAGGG + Intergenic
1168314939 19:55480934-55480956 GAGGCTAGCCAGGTCTGAGAAGG - Intronic
925299023 2:2796663-2796685 GACGGTAGCCAGGTCTGACAGGG + Intergenic
927762508 2:25772131-25772153 GAGTTTAGCCAGATCTGAGTGGG + Intronic
938390734 2:130903181-130903203 GATGTTAGCATTATCTGACAAGG - Intronic
942483728 2:176417810-176417832 GAGTTAAGCTACACCTGACATGG + Intergenic
944473410 2:200079801-200079823 GAGATTAGTTAGAATTGACAAGG + Intergenic
945985121 2:216347418-216347440 GAGGGTAGCTTGAACTGAGATGG + Intronic
946608107 2:221428620-221428642 GAAGTCAGCTAGATCTGGAAAGG + Intronic
946863798 2:224024832-224024854 GAGGTTAGATAAAGCTGAGAAGG - Intronic
947947287 2:234116259-234116281 GGGGTTAGTTAGAAGTGACACGG + Intergenic
1170644405 20:18184223-18184245 GAGCATACCTAGACCTGACAGGG - Intronic
1175262816 20:57685382-57685404 GAGGGGAGAGAGATCTGACAAGG - Intronic
1179354270 21:40644013-40644035 GAGTTTAACAAGATCTGCCATGG - Intronic
954339930 3:49945265-49945287 GAGGATAGCTTGAACTGAGAAGG - Intronic
955162587 3:56479175-56479197 GAGGCTAGCTGGCTCTGAGAAGG - Intergenic
956045779 3:65194374-65194396 GAGGGTAGCTAGATGTCTCATGG + Intergenic
956553789 3:70494209-70494231 GAGGTTAGATATATTTGAAAGGG - Intergenic
957891061 3:86359624-86359646 GAGTTTAGTTAAATCTGGCAAGG - Intergenic
961184230 3:124900721-124900743 GAGGTGAGCAAGATCTGTCTGGG - Intronic
975126975 4:70793912-70793934 GGGGGTAGCTTGAGCTGACAGGG + Intronic
977876018 4:102150926-102150948 GAGGTTAAAAAGATCTGAAAGGG - Intergenic
982367267 4:154593081-154593103 GGGGTGAGCTTGATCAGACAAGG - Intergenic
986026535 5:3856238-3856260 GGGGTTAGCTAGATGTGCCTGGG - Intergenic
986466552 5:8032033-8032055 GATGTTAGCACTATCTGACAAGG - Intergenic
1000461464 5:161525205-161525227 GGGGTCAGCCAGATCTGACCAGG - Intronic
1001493702 5:172173319-172173341 GAGGTTCGCCAGCTCTGACAAGG + Intronic
1016548593 6:145251818-145251840 GATATCAGCTAGATCTGAGAAGG - Intergenic
1024569957 7:50715153-50715175 GAGGTAAGCTAGGTCTGGCCTGG + Intronic
1030571597 7:111232495-111232517 GAGGTTAGCTAGATCTGACATGG + Intronic
1041198678 8:55428217-55428239 GAGATTAGCAAGACCAGACAGGG + Intronic
1053610553 9:39709117-39709139 GAGGGTGGTTAGATCTGAAATGG - Intergenic
1053868591 9:42467141-42467163 GAGGGTGGTTAGATCTGAAATGG - Intergenic
1054087700 9:60762040-60762062 GAGGGTGGTTAGATCTGAAATGG + Intergenic
1054242970 9:62633278-62633300 GAGGGTGGTTAGATCTGAAATGG + Intergenic
1054557094 9:66667796-66667818 GAGGGTGGTTAGATCTGAAATGG + Intergenic
1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG + Intronic
1189428678 X:40928340-40928362 GAAGTTAGAATGATCTGACAAGG - Intergenic
1189969619 X:46404998-46405020 GAGGTTAACCAGCTGTGACAGGG - Intergenic