ID: 1030578267

View in Genome Browser
Species Human (GRCh38)
Location 7:111317895-111317917
Sequence AATTTGTTATAGATTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030578266_1030578267 -5 Left 1030578266 7:111317877-111317899 CCAGGAAAGGTTCAATAAAATTT 0: 1
1: 0
2: 1
3: 26
4: 285
Right 1030578267 7:111317895-111317917 AATTTGTTATAGATTCTACATGG No data
1030578263_1030578267 26 Left 1030578263 7:111317846-111317868 CCTGTTAGAGTTAAGTGAAACTT 0: 1
1: 0
2: 0
3: 6
4: 147
Right 1030578267 7:111317895-111317917 AATTTGTTATAGATTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030578267 Original CRISPR AATTTGTTATAGATTCTACA TGG Intronic
No off target data available for this crispr