ID: 1030579002

View in Genome Browser
Species Human (GRCh38)
Location 7:111328786-111328808
Sequence GGGCACGTTGAAGTTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030579002 Original CRISPR GGGCACGTTGAAGTTTCATG TGG (reversed) Intronic
903342110 1:22661001-22661023 GGGGACGTTGATGGTTCTTGTGG - Exonic
912029772 1:105226233-105226255 TGGCACTTTGAAATTTCATTTGG - Intergenic
919465542 1:197919035-197919057 AGGCCCGCTGAAGTTTCGTGGGG + Intronic
920709078 1:208277895-208277917 GGGCAGGTTGTATTTTCATTTGG + Intergenic
922517966 1:226222867-226222889 GGGCGCGTGGAAACTTCATGAGG + Intergenic
1072853838 10:98925634-98925656 GAGCACATTAGAGTTTCATGAGG + Intronic
1073069785 10:100786062-100786084 TGGCAGGTTTATGTTTCATGAGG + Intronic
1073585587 10:104706899-104706921 GGGCACGTGGAAGATTGCTGTGG + Intronic
1077387506 11:2277297-2277319 GGGCAGCTTTCAGTTTCATGGGG - Intergenic
1080530478 11:33170530-33170552 GGGCATATGGAACTTTCATGAGG - Intergenic
1105985589 13:25563104-25563126 GACAACGTTGAAGTTTCAAGAGG + Intronic
1110184238 13:72654801-72654823 GGACAGGTTGCAGTCTCATGGGG - Intergenic
1111355428 13:87094838-87094860 GGGGAAGTTGAAGTGTCATCAGG + Intergenic
1128267356 15:66278592-66278614 GGGCACATTGGAATTCCATGTGG + Intergenic
1132215873 15:100061297-100061319 GGGCAAGCTGAAGCTTCAGGGGG - Intronic
1135970456 16:27068411-27068433 GGCCAGGATGAAGTTTCATGTGG - Intergenic
1142239493 16:88938730-88938752 GGGCACGCTGAAGTTGCTTCTGG + Intronic
1144412443 17:15014208-15014230 GTGCACGATGAAGTTTCAAGAGG + Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
925733593 2:6941698-6941720 GGGCAGGTTGCAGTTTTAAGTGG + Intronic
929531774 2:42757176-42757198 GGGGACATGGAAGTTTCACGAGG + Intergenic
932792842 2:74670915-74670937 TGGCCCTTTGAAGTTTCATAAGG + Intronic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
942670085 2:178365755-178365777 GTGAAAGTTTAAGTTTCATGGGG - Intronic
944171710 2:196786612-196786634 GGACACGTTGAAGATTTGTGAGG - Intronic
947338881 2:229116368-229116390 GGGCAGGATGAAGTGCCATGAGG - Intronic
1174664803 20:52247854-52247876 GGGCTCCTTGGTGTTTCATGAGG + Intergenic
1177944478 21:27450453-27450475 GGCCACCTTAAAGTTGCATGAGG + Intergenic
1183798895 22:40144858-40144880 GGGCATGTAGAAGTTTTCTGGGG + Intronic
955797369 3:62651816-62651838 GGGCAAGTTTATGTTTCAAGTGG - Intronic
956798710 3:72738411-72738433 GGGCACATTGAAGCTTCACCTGG - Intergenic
957494201 3:80969576-80969598 GGGCAAGATGCAGTCTCATGCGG + Intergenic
961050803 3:123745304-123745326 GGGCACTTAGGAGATTCATGGGG - Intronic
966619692 3:181950754-181950776 GTGCATGTTGAAGTTCCCTGAGG + Intergenic
975486303 4:74936751-74936773 GGGCACGTTCAAGTTTTTTATGG + Intronic
976683171 4:87780141-87780163 GAGCACCTAGAAGTTTCATGTGG + Intergenic
987538901 5:19227900-19227922 GGGCACCTTGAATTTTGAAGGGG + Intergenic
991914995 5:71597038-71597060 GGGCAAGTTGCAGTTTTAAGAGG + Intronic
993186442 5:84627988-84628010 GAGCACTTTGAAGTTTAAGGAGG - Intergenic
993827419 5:92709003-92709025 GGACAGGTGGAAGTTTCCTGTGG + Intergenic
998039915 5:138945390-138945412 GGGCAAGGTGAGGTTTGATGGGG - Intergenic
999435589 5:151560962-151560984 GGGAACGTTGAAGTCTAGTGAGG + Intronic
1004013189 6:11708977-11708999 GAGCAAATTGCAGTTTCATGTGG - Intergenic
1013301024 6:108805025-108805047 TGGCATGTTGCAGTTTCTTGTGG + Intergenic
1018433076 6:163738271-163738293 GGGCACTTTGAAGCCTCATCTGG - Intergenic
1030579002 7:111328786-111328808 GGGCACGTTGAAGTTTCATGTGG - Intronic
1033991060 7:147287582-147287604 GGGCAAGATGAAGTTACCTGGGG - Intronic
1036709106 8:11066986-11067008 GTGCATGTGGAAGCTTCATGGGG + Intronic
1037739679 8:21598373-21598395 GGGCACGTTAGAGTATGATGTGG + Intergenic
1038018415 8:23533466-23533488 GGGCACGTTTCAGCTGCATGTGG + Intronic
1038179394 8:25212440-25212462 GGCCACGGGCAAGTTTCATGTGG + Intronic
1038481244 8:27903080-27903102 GGGCAAGTTTAAGTGTCAGGGGG + Intronic
1041096063 8:54351400-54351422 GGGCACGCTGACATTTCATGCGG - Intergenic
1049998029 9:1049742-1049764 GGGCTCGGTGAAGGTTAATGAGG + Intergenic
1052787753 9:32845497-32845519 GTCCATGTTGAAGTTTCAAGTGG - Intergenic
1055272843 9:74581144-74581166 GGGCCTGGTGAATTTTCATGAGG - Intronic
1055934843 9:81595226-81595248 GTGCATGTTGAAATATCATGTGG - Intronic
1056491534 9:87112730-87112752 GGGGACGATGAAGTTACAAGAGG - Intergenic
1188729345 X:33627567-33627589 GGGCACGAGGAATCTTCATGTGG + Intergenic
1191134011 X:57044282-57044304 GGGCACAAGGAAGTTACATGAGG - Intergenic
1198644692 X:138793294-138793316 GAGCACGTAGTAGTTTCCTGTGG - Intronic
1200106387 X:153715585-153715607 GGGCACGGAAAAGCTTCATGTGG + Exonic
1202276622 Y:23127398-23127420 CGGTATCTTGAAGTTTCATGTGG + Intergenic
1202276626 Y:23127437-23127459 CGGCATCTTGAAGTTTCATGTGG + Intergenic
1202289402 Y:23293253-23293275 CGGCATCTTGAAGTTTCATGTGG - Intergenic
1202289406 Y:23293292-23293314 CGGTATCTTGAAGTTTCATGTGG - Intergenic
1202429615 Y:24761120-24761142 CGGTATCTTGAAGTTTCATGTGG + Intergenic
1202429619 Y:24761159-24761181 CGGCATCTTGAAGTTTCATGTGG + Intergenic
1202441172 Y:24908932-24908954 CGGCATCTTGAAGTTTCATGTGG - Intergenic
1202441176 Y:24908971-24908993 CGGTATCTTGAAGTTTCATGTGG - Intergenic