ID: 1030582781

View in Genome Browser
Species Human (GRCh38)
Location 7:111380827-111380849
Sequence TAAGGTTAGCAGTTTATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030582781 Original CRISPR TAAGGTTAGCAGTTTATGCC TGG (reversed) Intronic
903756821 1:25668029-25668051 TAAGGTTACCAGTTCACCCCAGG - Intronic
910675866 1:89816003-89816025 TAAGGCTAAGAGTTTAAGCCTGG + Intronic
911229930 1:95350307-95350329 TAAGGCTAGTATTTGATGCCTGG + Intergenic
917072266 1:171165202-171165224 TAAGAGTAGTAGTTTATGCCTGG + Intergenic
922113056 1:222581478-222581500 GAAATTTAGCAGTATATGCCAGG + Intronic
923882791 1:238122101-238122123 TAAGGTTAGCAGTTGACTCTAGG + Intergenic
1064957851 10:20931340-20931362 CTATGTTAGCAGTTTATGGCAGG - Intronic
1067984402 10:51125471-51125493 TGAGGTTAGGAGTTCAAGCCTGG + Intronic
1068911706 10:62385211-62385233 TTAGGTTAGCAGTTTGTGCCAGG + Intronic
1082091487 11:48093951-48093973 CAAGGTCAGCAGTTAATGCTGGG - Intronic
1085606336 11:77902982-77903004 TAAGGTTAGGAGTTTGAGACCGG - Intronic
1086087980 11:82975341-82975363 TAAGGTTACACATTTATGCCTGG - Exonic
1088264562 11:107976909-107976931 TCAGGTCAGCAGTTTATGGGTGG + Intergenic
1089373877 11:117980571-117980593 TAAGGTTTGCAGATTATTCAGGG + Intergenic
1091074335 11:132600984-132601006 TAATGTTAACTGTTTAAGCCAGG - Intronic
1093711027 12:22330123-22330145 TGAGGATAGAAGTATATGCCAGG - Intronic
1093966584 12:25333514-25333536 TGAGGTTAGGAGTTCAAGCCTGG + Intergenic
1094439251 12:30456761-30456783 AATAGTTAGCTGTTTATGCCTGG + Intergenic
1098682694 12:73378146-73378168 TGAGGTTAGGAGTTTAGGCAAGG + Intergenic
1104178979 12:126359749-126359771 TAAGGTTTGCTGTTTATTCGAGG + Intergenic
1106516222 13:30456425-30456447 ATAGTTTAGCAGTTTAGGCCAGG + Intergenic
1111350496 13:87022922-87022944 CAAGGTAAGCAGTTTATCACTGG + Intergenic
1116709695 14:48351712-48351734 TAAGGTTAGCATTGTATGGCTGG - Intergenic
1117092359 14:52263968-52263990 AAAGGTTAGAAGATTATGCAAGG + Intergenic
1117881623 14:60318461-60318483 TAAAATTAGAAGTTTAGGCCGGG + Intergenic
1118826911 14:69391933-69391955 TAAAGTTCGCAGTTTATGTTAGG - Intronic
1128649846 15:69402609-69402631 TAAGGAAAGGAGTTTAGGCCAGG - Intronic
1130677454 15:85966010-85966032 TTAAGTTAGTAGTTTAAGCCAGG + Intergenic
1130755250 15:86756133-86756155 TAATATTAGCATTTGATGCCAGG + Intronic
1132741861 16:1418012-1418034 TAAGGTCAGGAGTTCAAGCCTGG + Intergenic
1140073750 16:71676956-71676978 TGAGGTTAGGAGTTCAAGCCTGG - Intronic
1141267801 16:82512724-82512746 TAAGGTTAGCATTATTTGCCAGG + Intergenic
1147417564 17:40304441-40304463 TGTGGTTAGCAGTTTTTGCCAGG + Exonic
1149780191 17:59391447-59391469 TAATGTGAGCAGTACATGCCAGG + Intronic
1151781296 17:76247772-76247794 TGAGGCTAGGAGTTTAAGCCTGG - Intergenic
1154291079 18:13107280-13107302 TAAGGTCAGGAGTTTGAGCCAGG + Intronic
1155855157 18:30825017-30825039 TATGGTTAGCAATTTAAGGCAGG + Intergenic
1157482756 18:48066096-48066118 GAAGGTTAGGAGATGATGCCTGG - Intronic
1162099419 19:8330981-8331003 TGAGGTAAGCAGTTTGAGCCTGG + Intronic
1162135282 19:8551564-8551586 TAAGGTCAGGAGTTTAAGACCGG - Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165692603 19:37875312-37875334 TACAGTTAGCAGTTTCTGACTGG - Intergenic
928021118 2:27705982-27706004 TAAGGTCAGCAGTTTAATCAGGG - Exonic
928374307 2:30762630-30762652 TCAGGTAAGCAGGTGATGCCAGG - Intronic
932024631 2:68120771-68120793 TAAAGAAAGCAGTATATGCCAGG - Intergenic
935042293 2:99444235-99444257 TAAGGTTAGGATTTTATTTCAGG - Intronic
937819629 2:126294584-126294606 TAAGGTCAGGAGTTCAAGCCTGG - Intergenic
940885947 2:158989308-158989330 TAAGTTTAGCAATTCAGGCCAGG + Intronic
942656374 2:178218314-178218336 TCAGGATAACAGTTTCTGCCTGG + Intronic
944657325 2:201889099-201889121 TAAGGGCAGAAGTTTAGGCCAGG + Intronic
946617805 2:221528454-221528476 TAAGGTGAGCAGTTGGTGGCTGG - Intronic
1179080026 21:38162091-38162113 CAAGGCTAGCTGTATATGCCAGG - Intronic
1179386567 21:40948413-40948435 TAAGAGTAGAAGTTTAGGCCAGG - Intergenic
1183770135 22:39917327-39917349 TCAGGTTAGGGGTTTGTGCCAGG - Intronic
1183805658 22:40208379-40208401 TAAGGTTTCCAATTTTTGCCAGG - Intronic
950324266 3:12090668-12090690 CAAGGATAGCAGGTTATTCCTGG + Intronic
950775494 3:15346427-15346449 TAAGATTAGCAGCTTCTGCCGGG - Intergenic
952462483 3:33543156-33543178 TAAGGTCAGGAGTTTGTGACCGG + Intronic
955638973 3:61061435-61061457 TAGGGTTAGCAATTTATGAAAGG - Intronic
957279578 3:78133127-78133149 TAAGGTTATCAGTTTACTACGGG - Intergenic
963886438 3:150588033-150588055 TAAGGTGAGCATTTTATCCTTGG + Intronic
967241576 3:187444881-187444903 TAAAATTAGCAGTTTATTCACGG + Intergenic
971746671 4:30589177-30589199 TAATGTTAGCAATTTATAACTGG + Intergenic
972320693 4:37970966-37970988 TAAGTTTAGGAGGTGATGCCAGG - Intronic
974825266 4:67120159-67120181 TAATGTTAGGAGTTTATCCCAGG - Intergenic
975139946 4:70908477-70908499 TAAGATTAGCAATTTAGGCCGGG + Intronic
975294646 4:72719352-72719374 TGAGGTCAGGAGTTTAAGCCTGG + Intergenic
979157218 4:117411376-117411398 TAAGGTTTCCACTTTATACCAGG - Intergenic
980940145 4:139265908-139265930 GAAGATTAGCACTTTGTGCCAGG - Intergenic
981705580 4:147655823-147655845 TAAGAATAGCAATTTATGGCTGG - Intronic
984473437 4:180206571-180206593 TATGATTAGCAATATATGCCTGG - Intergenic
985522692 5:385387-385409 TCAGGTCAGGAGTTTATGACTGG - Intronic
989552421 5:42751337-42751359 TAAGGTCAGCAGTTTAAACTGGG - Intergenic
992535054 5:77692177-77692199 TATGGTTAGCAATTTATGTCAGG + Intronic
994895558 5:105697888-105697910 TACGGTTTGCAGTGTGTGCCCGG - Intergenic
997462566 5:134063760-134063782 TGTGGTTAGCAGTTCAGGCCAGG - Intergenic
1005126688 6:22454304-22454326 TAAGGTCAGCCCTTTTTGCCTGG + Intergenic
1005287574 6:24345201-24345223 TAAGGTTAATAATTAATGCCTGG + Intronic
1014729996 6:125021559-125021581 TAAGGTAAGCATTTTCTGGCCGG - Intronic
1016560768 6:145393245-145393267 TGAGTTTTGCAGTTTATTCCTGG - Intergenic
1016671360 6:146712399-146712421 TGAGGTTAGGAGTTTAAGACCGG - Intronic
1019037722 6:169075788-169075810 TATGGTTAGAAATTTATGTCTGG + Intergenic
1019846491 7:3508076-3508098 TATCAGTAGCAGTTTATGCCTGG - Intronic
1021475833 7:21059559-21059581 AAAGTTTAACAATTTATGCCAGG + Intergenic
1024780206 7:52838971-52838993 AAATGATAGCAGTTTATTCCAGG - Intergenic
1030582781 7:111380827-111380849 TAAGGTTAGCAGTTTATGCCTGG - Intronic
1031320529 7:120321040-120321062 AAAGGTTAGCATTTAATGCTGGG - Intronic
1032853145 7:135812279-135812301 TAAGATTAGCATTTGAGGCCGGG - Intergenic
1034126763 7:148678496-148678518 TAAGGTCAGGAGTTTGTGACCGG - Intergenic
1039700973 8:39961534-39961556 TAAGGTCAGGAGTTTGTGACGGG - Intronic
1042416854 8:68529682-68529704 TAAGCTTAGAATTTTATTCCAGG - Intronic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1045472016 8:102520996-102521018 TGAGGTCAGGAGTTTAAGCCTGG - Intergenic
1049931321 9:459650-459672 TCAGCTAAGCAGTTTTTGCCTGG + Intronic
1052118452 9:24678022-24678044 TAAGGTTAGCAATTTAATTCAGG - Intergenic
1053113049 9:35479064-35479086 TGAGGTTAGCAGTTACTTCCTGG - Intergenic
1055167519 9:73215282-73215304 TAAGGTGAAAAGTTTAAGCCTGG - Intergenic
1057624754 9:96667375-96667397 TAAGACTAGAAGTTTATACCAGG + Intergenic
1060536057 9:124389063-124389085 TGAGGATAGCAGTAAATGCCTGG + Intronic
1188987166 X:36778298-36778320 TAAGATTAGTAGTGTATGCATGG - Intergenic
1191205164 X:57825962-57825984 TAAGGTTAGAAGTTCTGGCCAGG - Intergenic
1194969173 X:100323971-100323993 TAAAGTTAGCAGTTTACAACTGG + Intronic
1195537486 X:106025120-106025142 TAAGGTGAGTAATTTAGGCCGGG - Intergenic
1197581542 X:128289720-128289742 TAAGGGTAGAAGTTTATTCAAGG + Intergenic