ID: 1030591069

View in Genome Browser
Species Human (GRCh38)
Location 7:111482546-111482568
Sequence GAGTCAAATTTATAGCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030591069 Original CRISPR GAGTCAAATTTATAGCTGCT AGG (reversed) Intronic
903237482 1:21959578-21959600 GTCTCCAATTTATAGCTGGTTGG + Intergenic
908169985 1:61494649-61494671 GGGTCAATTTTATGGCTTCTGGG - Intergenic
908304965 1:62803824-62803846 AAACCAAATTTATATCTGCTTGG + Exonic
911305559 1:96227901-96227923 GTGTCAATTTTCTAGCTGCAAGG - Intergenic
919421276 1:197373108-197373130 GAGGTAAAGTTATAGCTACTGGG - Intronic
920896962 1:210061312-210061334 GAGTCAAATTTGAAGCTTCTGGG + Intronic
923635520 1:235692365-235692387 GAGTCAGACTGATAGCAGCTAGG - Intronic
924700202 1:246443789-246443811 GAGTGAAATCTACAGCTGCAGGG - Intronic
1063618568 10:7623965-7623987 AATTCAAATTTATAGCTGAAGGG + Intronic
1064805711 10:19129224-19129246 AACTCCAATTTATAGCTGGTAGG - Intronic
1068162932 10:53290641-53290663 GAGTCAAGTTTATATCTGGCTGG - Intergenic
1068307311 10:55228676-55228698 GTGTCAAATGTATATTTGCTAGG - Intronic
1070241036 10:74681110-74681132 GGGGCAAAGTAATAGCTGCTGGG - Intronic
1071415794 10:85440089-85440111 GAAACAGATTTATAGCTGTTTGG - Intergenic
1074275469 10:111997495-111997517 GAGTCACATTTAGAGCTGTTGGG - Intergenic
1074498389 10:114000109-114000131 GATTCAAATCCATGGCTGCTTGG - Intergenic
1078502822 11:11899811-11899833 GAGTGAAGTTTATAGCAGGTGGG + Intronic
1085661651 11:78373203-78373225 GAGTCATATCTAAAGCTACTAGG + Intronic
1086430929 11:86736265-86736287 GAGTCAGATTTGTAACTTCTCGG - Intergenic
1089795155 11:120974304-120974326 AAAACAAATTTAGAGCTGCTTGG - Intronic
1091071898 11:132573180-132573202 GAGACAAAATTATAACTGTTTGG - Intronic
1091553162 12:1552211-1552233 GTGCCACATTTATAACTGCTTGG - Intronic
1094698155 12:32842212-32842234 GAGGCAACTTTACACCTGCTGGG - Intronic
1095955758 12:47804902-47804924 GAGGCAAAGTCATACCTGCTGGG - Intronic
1096817943 12:54213444-54213466 GAATCCAATCTAGAGCTGCTTGG - Intergenic
1101202885 12:102455198-102455220 GACTCAAACTTAAAGCTGTTTGG + Intronic
1105353515 13:19636918-19636940 AAGTCAAATTTATAAATCCTAGG + Intronic
1108167144 13:47705266-47705288 AAGTCACATTCATAGCTGCCAGG + Intergenic
1108489566 13:50967638-50967660 GAGTCAAAGTTAGAGCCACTGGG - Intronic
1108932944 13:55852737-55852759 GAGTCAAGTTTATTGGTGATAGG + Intergenic
1110040778 13:70755177-70755199 GAGTTAAAAATATAGATGCTGGG - Intergenic
1111172508 13:84546089-84546111 GGGTCAAGTTTATACCTGGTAGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1116626230 14:47267863-47267885 AAGTCAAAGTTATAGTTTCTAGG + Intronic
1120343641 14:83255165-83255187 CCCTCAAATTTATAGCTGGTTGG - Intergenic
1121910572 14:97788496-97788518 GAGTTAAATACTTAGCTGCTTGG + Intergenic
1122044610 14:99014463-99014485 GAGTCACATTTGTAGCTTGTCGG + Intergenic
1123540425 15:21284241-21284263 GAGTCAAAGTTTGAGCTCCTTGG + Intergenic
1127598669 15:60512965-60512987 TGGTTAAATTTATAGCTGATGGG + Intronic
1127819681 15:62644074-62644096 GAGACAAGTCTATACCTGCTGGG + Intronic
1129962677 15:79702102-79702124 AATTCAAATTTATAACTCCTAGG - Intergenic
1131781176 15:95861434-95861456 GTGTTAACTTTTTAGCTGCTGGG + Intergenic
1202948739 15_KI270727v1_random:11383-11405 GAGTCAAAGTTTGAGCTCCTTGG + Intergenic
1137844536 16:51674422-51674444 GAGTCCATTTTCCAGCTGCTAGG - Intergenic
1138173120 16:54871553-54871575 CAGTCACATTTTTAGGTGCTGGG - Intergenic
1138786860 16:59856690-59856712 TAGTCTAATTAATGGCTGCTGGG + Intergenic
1140298090 16:73728059-73728081 CAGTCACATTTTTAGATGCTGGG - Intergenic
1141399587 16:83735549-83735571 GAGTCAAATTCATGGCAGCAGGG - Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1152144020 17:78556809-78556831 GAGTCAATTTTATTGCTGAGTGG - Intronic
1153614871 18:6925027-6925049 CAGCCAAAATTATAGCTGCAGGG + Intergenic
1158904455 18:61998619-61998641 GAGTCAGATTTATTGCGTCTGGG - Intergenic
1160120277 18:76124161-76124183 GATATAAATTTATAGCTCCTGGG + Intergenic
1162233339 19:9284907-9284929 GACTCAAATTTAGACCTACTGGG - Intergenic
1167645198 19:50702023-50702045 GAGGCAAAGTTAAGGCTGCTCGG + Intronic
1168527853 19:57103143-57103165 CAGTCACATTTCTAGGTGCTGGG + Intergenic
929373103 2:41250608-41250630 AAGTAAAATTCATAGCTTCTGGG + Intergenic
931745939 2:65292182-65292204 GAGTTACATTTATGGCAGCTCGG + Intergenic
936627666 2:114165554-114165576 GTGTCAACTTTATGGCTCCTTGG + Intergenic
936730354 2:115374896-115374918 GAAACAAATTTTTACCTGCTAGG + Intronic
937486397 2:122319427-122319449 GAGTTAAATTTATAAATGCTAGG + Intergenic
939478531 2:142717748-142717770 GATGGAAATTTATAGCTGGTTGG - Intergenic
941228779 2:162882855-162882877 AAGTTACATTTATAGCTACTGGG + Intergenic
941886668 2:170535203-170535225 GAGACAAATTTAAAGGTGCTCGG + Intronic
942545690 2:177061353-177061375 GAGTCCAAAATATAGGTGCTAGG - Intergenic
943679056 2:190748742-190748764 GAGCCTGATTTATAGCTGGTTGG - Intergenic
943860221 2:192852364-192852386 GATACATTTTTATAGCTGCTTGG - Intergenic
945318853 2:208398285-208398307 GAGTCACATTTATCACTCCTTGG + Intronic
948056826 2:235014836-235014858 CAGTCACATTTACAGCTACTGGG + Intronic
1173875401 20:46367373-46367395 TAGACAAAGTCATAGCTGCTGGG + Exonic
1179720173 21:43311821-43311843 CAGTCACATTTATAGGTTCTGGG + Intergenic
1181951599 22:26557708-26557730 GAGGCCAAGTGATAGCTGCTGGG + Intronic
1183813775 22:40281300-40281322 CTCTCAAATTTATAACTGCTTGG + Intronic
949280935 3:2345823-2345845 TCGTCAAATTTATAGAAGCTCGG - Intronic
949659568 3:6262240-6262262 GAGTCAACTGCAAAGCTGCTAGG - Intergenic
950156658 3:10726099-10726121 GAGGCAAGTTTATTGCTCCTGGG - Intergenic
960049258 3:113224662-113224684 GACTTAAATTTAAACCTGCTGGG + Intronic
960334081 3:116394541-116394563 GAGTCAAAATTATAGCAGGTTGG - Intronic
961134573 3:124497866-124497888 GTGTCAAAGTCAGAGCTGCTGGG - Intronic
961156971 3:124687938-124687960 GAGACAAGTCTATCGCTGCTTGG + Intronic
962579960 3:136789324-136789346 GTTGCAAATTTATAGCTGCAAGG + Intergenic
964081032 3:152757133-152757155 GTGTCCAATATATAGATGCTTGG - Intergenic
965208292 3:165750229-165750251 AACTCCAATTTATAGCTGATAGG + Intergenic
965920176 3:173903969-173903991 CAGTAAACTTTGTAGCTGCTTGG - Intronic
967783325 3:193463362-193463384 GAGTGAAATTTTTACCTGCAGGG + Intronic
971103225 4:23493247-23493269 GAGTCAATTTTATAACTGCTGGG + Intergenic
971494894 4:27253278-27253300 AGGTCACATTTATAGGTGCTTGG + Intergenic
975378843 4:73675109-73675131 GAGGCAATATTATAGCTACTTGG + Intergenic
975936415 4:79586337-79586359 TACTCAAACTTATATCTGCTTGG - Intergenic
980767269 4:137322643-137322665 GAGGGAAATTTATAGATGCTCGG + Intergenic
983726445 4:170934104-170934126 CAGTCACATTTATATGTGCTTGG - Intergenic
984318970 4:178166666-178166688 AAGTCAAGTTGATAGCTGATAGG + Intergenic
986095792 5:4553061-4553083 GAGTTAAATTTTGAGTTGCTTGG + Intergenic
986111940 5:4728046-4728068 CAGTCACATTTATAGGTTCTGGG - Intergenic
989981658 5:50653240-50653262 CAGTAAAATTTCTAGATGCTGGG - Intergenic
993396256 5:87392956-87392978 TAGTTAAATATATTGCTGCTAGG - Intronic
993535795 5:89084661-89084683 TAGTTATAGTTATAGCTGCTAGG - Intergenic
993603993 5:89964428-89964450 GAGTCAAAGATATAAATGCTAGG + Intergenic
996494455 5:124138058-124138080 TTGCCACATTTATAGCTGCTAGG + Intergenic
1000579474 5:163017618-163017640 AAGTGAAATTAATAGCTGGTTGG - Intergenic
1001915776 5:175558771-175558793 AAGACAAATTTAGCGCTGCTGGG + Intergenic
1006709649 6:36056545-36056567 GGTTCAAACTTACAGCTGCTTGG + Intronic
1007559439 6:42794173-42794195 AAGTCAGATTTATAGTAGCTAGG - Intronic
1008403846 6:51096952-51096974 GAGTCAAATTTATATCTATCTGG - Intergenic
1022125197 7:27349520-27349542 CAGTCACATTTATATCTGCTTGG + Intergenic
1023190710 7:37578161-37578183 AAGCCAAAATTATAGCTCCTGGG - Intergenic
1026439152 7:70428194-70428216 AAGTGAAATTTAAAGCTACTGGG - Intronic
1027691855 7:81357456-81357478 GAGTAAAATTTTTAGTTCCTAGG - Intergenic
1028628206 7:92901783-92901805 TATTCTCATTTATAGCTGCTGGG - Intergenic
1030137118 7:106264798-106264820 GAGTTAAACTTATACCTACTTGG - Intronic
1030591069 7:111482546-111482568 GAGTCAAATTTATAGCTGCTAGG - Intronic
1038899676 8:31828410-31828432 GGGTCAAAATTATAGCTGCGTGG + Intronic
1045611002 8:103841570-103841592 GAGTAAAATGTCTAGCTGATTGG - Intronic
1046337548 8:112809650-112809672 GAGTCCAATTCCTAGCTGTTTGG - Intronic
1048321698 8:133405292-133405314 GGGTCAAAAATATAGCTGCCTGG - Intergenic
1052091655 9:24336114-24336136 GAAGCAAAAGTATAGCTGCTTGG - Intergenic
1052095068 9:24373827-24373849 GAGACAAATGTATATCTGATTGG - Intergenic
1053112572 9:35475318-35475340 TAGGCAAAATTATAGCTTCTAGG + Intergenic
1058855760 9:109060502-109060524 GAGTAAAATTAATATATGCTGGG + Intronic
1186316787 X:8379255-8379277 GAGTCATATTCCTAGCTCCTGGG + Intergenic
1187876379 X:23807371-23807393 GAGTCACATATCTTGCTGCTAGG - Intergenic
1188047717 X:25447365-25447387 GAGTCAAAACCATAGCTGCTGGG + Intergenic
1188401013 X:29744520-29744542 GATTCATATTTATATTTGCTGGG + Intronic
1192451364 X:71247153-71247175 GAGTCTTATTTAAAGCTTCTTGG - Intronic
1198132407 X:133710450-133710472 GAATCAAATTTCTATCTGGTTGG - Intronic
1199916229 X:152344064-152344086 GAATCAAATTTCTGGCTGCTAGG - Intronic