ID: 1030606559

View in Genome Browser
Species Human (GRCh38)
Location 7:111644418-111644440
Sequence CTGTGTGCACAGGCATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030606559_1030606566 27 Left 1030606559 7:111644418-111644440 CCCATGCATGCCTGTGCACACAG No data
Right 1030606566 7:111644468-111644490 GGCAAGCCACTCAGGTGCCGAGG No data
1030606559_1030606564 6 Left 1030606559 7:111644418-111644440 CCCATGCATGCCTGTGCACACAG No data
Right 1030606564 7:111644447-111644469 GTTATGCTTTTCTCTGTGGGTGG No data
1030606559_1030606562 2 Left 1030606559 7:111644418-111644440 CCCATGCATGCCTGTGCACACAG No data
Right 1030606562 7:111644443-111644465 ATCTGTTATGCTTTTCTCTGTGG No data
1030606559_1030606563 3 Left 1030606559 7:111644418-111644440 CCCATGCATGCCTGTGCACACAG No data
Right 1030606563 7:111644444-111644466 TCTGTTATGCTTTTCTCTGTGGG No data
1030606559_1030606565 19 Left 1030606559 7:111644418-111644440 CCCATGCATGCCTGTGCACACAG No data
Right 1030606565 7:111644460-111644482 CTGTGGGTGGCAAGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030606559 Original CRISPR CTGTGTGCACAGGCATGCAT GGG (reversed) Intergenic
No off target data available for this crispr