ID: 1030611301

View in Genome Browser
Species Human (GRCh38)
Location 7:111692405-111692427
Sequence TCGACTGTGCTTCCTGCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030611301_1030611306 11 Left 1030611301 7:111692405-111692427 CCTACGGCAGGAAGCACAGTCGA No data
Right 1030611306 7:111692439-111692461 TCCAGACTGGGAAAGTGATCAGG No data
1030611301_1030611304 -1 Left 1030611301 7:111692405-111692427 CCTACGGCAGGAAGCACAGTCGA No data
Right 1030611304 7:111692427-111692449 AGCCACATGGAATCCAGACTGGG No data
1030611301_1030611303 -2 Left 1030611301 7:111692405-111692427 CCTACGGCAGGAAGCACAGTCGA No data
Right 1030611303 7:111692426-111692448 GAGCCACATGGAATCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030611301 Original CRISPR TCGACTGTGCTTCCTGCCGT AGG (reversed) Intergenic
No off target data available for this crispr