ID: 1030611303

View in Genome Browser
Species Human (GRCh38)
Location 7:111692426-111692448
Sequence GAGCCACATGGAATCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030611301_1030611303 -2 Left 1030611301 7:111692405-111692427 CCTACGGCAGGAAGCACAGTCGA No data
Right 1030611303 7:111692426-111692448 GAGCCACATGGAATCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030611303 Original CRISPR GAGCCACATGGAATCCAGAC TGG Intergenic
No off target data available for this crispr