ID: 1030614854

View in Genome Browser
Species Human (GRCh38)
Location 7:111728715-111728737
Sequence AGAGCCCTGCTCCGGGGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030614844_1030614854 21 Left 1030614844 7:111728671-111728693 CCTGGCGAGTGGTACTCCACTGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 268
1030614850_1030614854 5 Left 1030614850 7:111728687-111728709 CCACTGGAGAGGGGGTGAAAGAC 0: 1
1: 0
2: 1
3: 22
4: 219
Right 1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030614854 Original CRISPR AGAGCCCTGCTCCGGGGAGA AGG Exonic
900562768 1:3315840-3315862 AGAGCCGGGCTCCGAGGTGAGGG + Intronic
901127484 1:6939755-6939777 AGAGCCCTGCGCCGTGACGAAGG - Intronic
902370669 1:16005033-16005055 AGAGCCCAGCACAGGGTAGAGGG - Intronic
902783613 1:18719500-18719522 AGACCCCTGGTCTGGTGAGAGGG - Intronic
903767051 1:25741691-25741713 AGAGCCCTTCTTCTGTGAGAGGG - Intronic
904131792 1:28280996-28281018 TCAGCCCTGCTCCTGGGAGCTGG + Exonic
904492779 1:30870903-30870925 AGAGCACAGCTCTGGTGAGACGG - Intronic
904706346 1:32394040-32394062 AGGGCCCTGCTGAGGGAAGAAGG + Intronic
905553155 1:38859775-38859797 AGAGCCGGGCTCCGGGGGGCGGG - Exonic
906719472 1:47995079-47995101 AGAGTCCTGCTCTGGCAAGAAGG + Intronic
907358169 1:53893390-53893412 AGAGCCCTCCCCAGGGGATATGG - Intronic
907560333 1:55381890-55381912 TGGGCCCTGCTTCTGGGAGAGGG + Intergenic
910984764 1:92994741-92994763 AGGGCCCAGCTCCTGGGAAATGG + Intergenic
912956745 1:114159285-114159307 AGAGCCCTGCTTCCAGGAAAGGG + Intergenic
913209645 1:116571654-116571676 AAATCCCAGCTCCGGGGATAAGG - Intergenic
914948145 1:152085302-152085324 AGAGCCCTGTTCTGTGGAGAGGG - Exonic
917854498 1:179089850-179089872 AGACCCCTGTCTCGGGGAGAGGG - Intronic
919166947 1:193907552-193907574 AGACCACTGCTGCTGGGAGAAGG - Intergenic
920174157 1:204089748-204089770 GGAGGCCAGCTCAGGGGAGAGGG - Intronic
920385548 1:205568618-205568640 ACAGCCCGGGTGCGGGGAGAGGG + Intergenic
922359178 1:224805242-224805264 AGAGACCTGCCGTGGGGAGATGG + Intergenic
922550526 1:226491007-226491029 AGGACCCTGTTCCAGGGAGATGG - Intergenic
922730955 1:227948402-227948424 AGCGCCCAGCTCGGGGCAGACGG - Intergenic
923542565 1:234899051-234899073 AAAGCCCTCCTCCGGGCTGAAGG - Intergenic
1062840561 10:666923-666945 AGAGCCAGGCACCAGGGAGAGGG + Intronic
1062858000 10:789151-789173 AGAGCTCTGCTCCGGGGCCAGGG + Intergenic
1062902433 10:1156325-1156347 AGAGCCCAGCCCTGGGGACACGG - Intergenic
1062902452 10:1156373-1156395 AGAGCCCAGCCCTGGGGACACGG - Intergenic
1062959913 10:1565032-1565054 AGAGCCCTGCACGGGAGGGAGGG - Intronic
1063185950 10:3651786-3651808 AAAGCTCTGCTTCAGGGAGAAGG + Intergenic
1063894166 10:10661952-10661974 ACAGCCCTGCTCCAGGGCTATGG + Intergenic
1067077393 10:43196021-43196043 AGGGCCCTGCTTTGGGGAGGGGG - Exonic
1069794059 10:71041220-71041242 TGAGCCATGCTCAGGGCAGAGGG + Intergenic
1070440252 10:76436108-76436130 AGAGCCCAGCTCTGTGGTGATGG + Intronic
1072944289 10:99796052-99796074 AGAGCCCTGATCAAGAGAGATGG + Intronic
1076114042 10:127882937-127882959 CCAGCCCTGCTCTGGGCAGATGG + Intronic
1076281781 10:129252501-129252523 AGAAACCTGCTCCTGGCAGAGGG + Intergenic
1076566518 10:131403114-131403136 TGTGCCCTGTTCCGGGGAGGGGG - Intergenic
1076809063 10:132877347-132877369 AGCGTCCTGCTCTGGGGAGCTGG + Intronic
1077446161 11:2591923-2591945 AGAGCCCTGGCTTGGGGAGAAGG + Intronic
1080048446 11:27834367-27834389 GGAGCTCTGCTCAGGGGACAGGG + Intergenic
1083961248 11:66016166-66016188 AGGACCCTGCTGCTGGGAGAGGG - Intergenic
1084336301 11:68459997-68460019 AGTGCCCTTGTCCTGGGAGAAGG - Intergenic
1084433211 11:69122943-69122965 AGAGCACTGCTGCAGGGCGAGGG - Intergenic
1085291424 11:75402756-75402778 AGAGCCCTGTTGCGGGGGGCGGG + Intronic
1085391265 11:76183511-76183533 TGAGCCCCACTCCGGGGAGGTGG - Intergenic
1085410624 11:76288387-76288409 AGAGAACTGCTCCGGTGAAATGG + Intergenic
1085429204 11:76432404-76432426 TAAGACCTGCTTCGGGGAGAAGG + Intergenic
1086345044 11:85887410-85887432 AGAGCCCTGATAGGGGGACATGG - Intronic
1086623036 11:88911202-88911224 AAAGCTCTGCTCCAGGCAGAAGG + Intronic
1089076497 11:115742759-115742781 AGAAGCCTGCTCAGGGGAGGTGG + Intergenic
1089084725 11:115807303-115807325 AGAGCCCTGCCCCAGGCAGTAGG - Intergenic
1089191394 11:116656111-116656133 TGAGCCTTGCTCTGGGCAGATGG - Intergenic
1090326868 11:125895394-125895416 AGAGCCCAGGTGAGGGGAGATGG - Exonic
1091196189 11:133732756-133732778 TGAGCCCTGCTCCAGGATGATGG + Intergenic
1096503862 12:52080984-52081006 GGAGCGCTGCTCCGGGAAGTGGG + Intergenic
1096647965 12:53048478-53048500 CCAGCCCTGCTTGGGGGAGATGG - Intronic
1097323943 12:58254812-58254834 AGAGCTGTGCTAGGGGGAGAGGG + Intergenic
1104428588 12:128697925-128697947 AGAGCCATGCTCAGCGGTGAGGG - Intronic
1104962192 12:132493593-132493615 AGAGACCTGCCCCGGGCACAGGG - Intronic
1105769453 13:23594636-23594658 AGTGCTCTGTTCCAGGGAGATGG - Intronic
1108199532 13:48029115-48029137 AGAGCCTGGCTCTGGGGTGATGG - Intergenic
1118760792 14:68879282-68879304 GCAGCCCTGCTCCAGGGAGCAGG + Intronic
1118818800 14:69331384-69331406 AGCTGCCTGCTCTGGGGAGAAGG - Intronic
1120435262 14:84473726-84473748 AGTGCCCTGGTCAGGGGAGGAGG + Intergenic
1120981977 14:90298326-90298348 AGAGCCCCGGGCTGGGGAGAAGG - Exonic
1121714197 14:96061093-96061115 AGAGCCCAGCACCAGGGAAATGG - Intronic
1121715347 14:96070026-96070048 AGAGCCCTGCCCCAGGAAGAGGG + Intronic
1122347848 14:101071503-101071525 ACAGCCTTGCTCCAAGGAGAAGG + Intergenic
1122374361 14:101248397-101248419 AGTGCCTGGCCCCGGGGAGAAGG - Intergenic
1122428963 14:101628022-101628044 AGAACCCTGCACAGAGGAGACGG + Intergenic
1122443849 14:101754984-101755006 AGCGCCCTGCTCCAGTGAGCAGG - Intergenic
1122857208 14:104565678-104565700 AGAGCCCAGCCCCGAGGACAAGG + Intronic
1122995231 14:105260070-105260092 AGAGCCCTGCTCTGGGCTGACGG + Intronic
1123030135 14:105447701-105447723 AGAGCCCAGCTGCAGGGAGCAGG + Intronic
1123060408 14:105591842-105591864 AGAGCCCTGCTCCGCCGCGCTGG + Intergenic
1123080052 14:105688110-105688132 GGAGCCCTGACCCGGGGAGTCGG + Intergenic
1126786199 15:52179632-52179654 AGGGCCCTGCTCCCGGGCGGTGG + Intronic
1128219607 15:65958908-65958930 GGAGCCCAGCTCTGGGGATAAGG + Intronic
1128241130 15:66101699-66101721 AGAGCCCTGATGAGAGGAGAGGG - Intronic
1128559949 15:68658238-68658260 GGAGCCCTGGACCAGGGAGAGGG + Intronic
1128584847 15:68839602-68839624 AGAGCCCAGGTAGGGGGAGAAGG + Intronic
1130688496 15:86059898-86059920 CCCGCCCTGCTCCTGGGAGAAGG - Intergenic
1131869312 15:96745299-96745321 AGGGCTCAGCTCAGGGGAGAGGG - Intergenic
1132442836 15:101885855-101885877 GGTGCTCTGTTCCGGGGAGATGG + Intergenic
1132818620 16:1848936-1848958 ATAGCACTTCTCAGGGGAGAGGG + Intronic
1132862259 16:2077542-2077564 AGAGCCCAGCTCCCGGGAAGGGG - Intronic
1133988964 16:10690187-10690209 ACAGCTCTCATCCGGGGAGAAGG - Intronic
1134137132 16:11684789-11684811 AGAGGCCTGCCCCGGGCAGCTGG + Intronic
1137559260 16:49492514-49492536 GGGGCCCTGCTCCAGGGAGCAGG - Intronic
1137676415 16:50305818-50305840 AAAGCCCTTCTCCAGGAAGATGG - Exonic
1138497380 16:57416573-57416595 AGACCCCAGCTCCAGGGCGAGGG + Intergenic
1138598559 16:58042047-58042069 AGAGCCCTGAGCTGGGGAGCTGG - Intronic
1139670528 16:68490167-68490189 AGAGACCTGTTCCAGGGAGGTGG + Intergenic
1141427314 16:83952742-83952764 AGAGCCCTGCAGCTGGGAAATGG + Intronic
1141591633 16:85073171-85073193 CCAGCCCTGCTCCCGCGAGATGG - Intronic
1142051257 16:87959745-87959767 AGAGCCCAGGTCCCGGGTGAGGG + Intronic
1142117248 16:88365517-88365539 AGAGCCCTGCCCCTGGCAGCAGG - Intergenic
1142150819 16:88511882-88511904 TGAACCCTGGTCCAGGGAGATGG + Intronic
1143238134 17:5420362-5420384 TTAGCCCTGCTCCGTGGAGCAGG + Intronic
1143289293 17:5816826-5816848 GGAACCCTGCTAGGGGGAGAGGG + Intronic
1143490437 17:7282553-7282575 AGAGCCATGCCCAGGGGAGGAGG - Intronic
1143757730 17:9079215-9079237 AGAACCCTGCTCCAGGGTGGTGG + Intronic
1144776666 17:17788242-17788264 AGAGGCCTGCTTCGGGCAGATGG - Intronic
1144793864 17:17877988-17878010 AGAGCCGTGCTCCTGGCAGCAGG - Intronic
1146579147 17:34021464-34021486 AGAGCCCTGCCCTAGGGAAAAGG - Intronic
1146842873 17:36167256-36167278 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1146855178 17:36255197-36255219 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1146865442 17:36333178-36333200 AGGGCCCTGCGAGGGGGAGAGGG - Intronic
1146871084 17:36379108-36379130 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1146878444 17:36430190-36430212 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1146882393 17:36451336-36451358 AGGGCCCTGCGAGGGGGAGAGGG + Intergenic
1147068303 17:37933772-37933794 AGGGCCCTGCGAGGGGGAGAGGG - Intronic
1147073970 17:37979732-37979754 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1147079834 17:38013327-38013349 AGGGCCCTGCGAGGGGGAGAGGG - Intronic
1147085491 17:38059270-38059292 AGGGCCCTGCGAGGGGGAGAGGG + Intronic
1147095775 17:38137269-38137291 AGGGCCCTGCGAGGGGGAGAGGG - Intergenic
1147101438 17:38183236-38183258 AGGGCCCTGCGAGGGGGAGAGGG + Intergenic
1147313180 17:39606813-39606835 GGGGCCCAGCGCCGGGGAGAGGG - Intronic
1147615235 17:41823440-41823462 GGAGCCCTGCTCTGTGGAGGGGG + Intergenic
1147864943 17:43545860-43545882 CGAGCCCGGCTCCTGGGAGCAGG - Intronic
1148053221 17:44779398-44779420 AGAGCCTCGCTCAGGGAAGAAGG + Intronic
1148450937 17:47777533-47777555 AGAGCCCAGCTTCAGGGAGGTGG - Intergenic
1149846038 17:60009742-60009764 AGGGCCCTGCGAGGGGGAGAGGG + Intergenic
1150084387 17:62266322-62266344 AGGGCCCTGCGAGGGGGAGAGGG + Intergenic
1152211598 17:79005337-79005359 TGAGCCCTTCTCCTGGGAAAGGG - Intronic
1152609777 17:81309866-81309888 GGGGCCCTGCTCCGGGGGGTTGG + Intergenic
1152648582 17:81481659-81481681 GGACCCCTGCTCCGGGGCGGGGG - Intergenic
1153285682 18:3452257-3452279 GGTCCCCAGCTCCGGGGAGAGGG - Exonic
1155843092 18:30670168-30670190 AGAGCCCAGCTAGGGGGAGAGGG - Intergenic
1157288311 18:46392587-46392609 GGAGCCCTTGTCCGGGGTGATGG + Intronic
1157880661 18:51318203-51318225 AGTGCCATGCTCCAAGGAGAGGG - Intergenic
1160337506 18:78055424-78055446 GGAGCGCTGCTCTGGGGAGTGGG + Intergenic
1160736247 19:663574-663596 AGAGCGCTGCACCGGGCAGCGGG - Intergenic
1161079555 19:2303730-2303752 AGTGCCCTGCTCTCTGGAGATGG - Intronic
1161207578 19:3049393-3049415 AGAACCCTGTTCCAGGCAGAGGG + Intergenic
1162019049 19:7860450-7860472 AGAGCCCTTCAGCAGGGAGAGGG - Intronic
1163062075 19:14768181-14768203 AGAGCCCAGCTCCAGGCACATGG + Intronic
1164442575 19:28290717-28290739 ACAGCACTGCTCTAGGGAGAAGG - Intergenic
1165069860 19:33248985-33249007 AGAGGACTGCTTAGGGGAGAAGG - Intergenic
1165224870 19:34347701-34347723 AGCACCCTGCTGTGGGGAGATGG - Intronic
1165403595 19:35617197-35617219 AGAGTCCTGGTCATGGGAGAAGG + Intronic
1165837651 19:38769678-38769700 GGAGCCCTGCTCAGGTGAGGAGG - Intronic
925103237 2:1267285-1267307 AGGGCCCTGGTGTGGGGAGAAGG - Intronic
925298843 2:2795685-2795707 AGAGGCCTGCTGTGGGGAGCGGG + Intergenic
926109612 2:10173562-10173584 AGAGCCCTGCCCAGGGGTGGTGG - Intronic
926121236 2:10242238-10242260 AGTTCCCGGCTCCGGGGAGGGGG - Intergenic
926777874 2:16439986-16440008 AGAGCCTTGCTCTGTGGTGAGGG - Intergenic
926844775 2:17124162-17124184 AGAGCCATGCTCTGAGGAGATGG + Intergenic
927867562 2:26600653-26600675 AGAGCCCATGTCCTGGGAGAAGG + Intronic
928374783 2:30765425-30765447 AGAGCCCTTCACAGGGTAGAAGG + Intronic
929257703 2:39830594-39830616 AGTGCTCTGTCCCGGGGAGATGG + Intergenic
929438869 2:41949840-41949862 AGACCCCTGCTCAGAGGAAATGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934728077 2:96638051-96638073 CGAGCCCTGCCCCAGGGAGCGGG - Intronic
935661326 2:105469130-105469152 ACAGCGCTGCTCCGGAGTGAAGG + Intergenic
937280000 2:120711258-120711280 AGAACCCTGGTCCTTGGAGAGGG + Intergenic
939100265 2:137887589-137887611 AGAGCCCTGTTACAGGGCGAAGG - Intergenic
941883588 2:170505797-170505819 AGACCACTCCTCCTGGGAGAAGG - Intronic
943597962 2:189879796-189879818 AGAGCCCTTGGCCTGGGAGAAGG + Intronic
947969677 2:234312457-234312479 AAATCCCTGACCCGGGGAGAAGG - Intergenic
948111989 2:235463739-235463761 AGAGCCCTCCGCTGGGGAGCAGG - Intergenic
948795591 2:240400677-240400699 AGAGCCCGGCCCCAGAGAGAAGG + Intergenic
1169292585 20:4365256-4365278 AGAGCCCAGCTCAGGGAAGATGG + Intergenic
1169383207 20:5126822-5126844 CGAGCCCTGCTCCCGGGAGAGGG + Exonic
1171416704 20:24986391-24986413 GGAGCCCAGCTCCTGGAAGAGGG + Intronic
1171444801 20:25195810-25195832 AGTGCCCTTTTCCGGGGAGCAGG - Exonic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1173528418 20:43750216-43750238 AGAACACTGCTCCAGGGAGGTGG + Intergenic
1173614769 20:44395484-44395506 AGATCCCAGCTCCAGGAAGAGGG + Intronic
1174109302 20:48187132-48187154 AGAGACCTGCTCCGGGACGTTGG - Intergenic
1175092282 20:56514090-56514112 TGAGCCCTCCCACGGGGAGAGGG + Intronic
1175861355 20:62151935-62151957 GGAGGCCAGCTCTGGGGAGAGGG - Intronic
1179807934 21:43851907-43851929 ACAGCCCTGGTCGGGGGAGCTGG + Intergenic
1179994705 21:44968513-44968535 AAAGCCAAGCTCCTGGGAGACGG - Intronic
1181031067 22:20149116-20149138 AGGGCCCTGCTTGGGCGAGAGGG - Intronic
1181681032 22:24495796-24495818 CAAGCCCGGCTCCGGGGAGGAGG - Intronic
1181830693 22:25558208-25558230 AGAGATCTGGTCCAGGGAGAAGG + Intergenic
1182550960 22:31100515-31100537 AGGGCTGTGCCCCGGGGAGAGGG - Intronic
1183377252 22:37472448-37472470 GGGGTCCTCCTCCGGGGAGAAGG + Exonic
1184296867 22:43530475-43530497 AGAGCCCAGGTGTGGGGAGAGGG + Intronic
1184762058 22:46550401-46550423 ACTGCCCTGCTCCGCGGTGAAGG - Intergenic
1185006293 22:48278760-48278782 AGAGGCCTGGTCCAGGGGGACGG + Intergenic
949511853 3:4773153-4773175 TGAGCCCTACTCCAGTGAGATGG - Intronic
949709852 3:6861105-6861127 ACAGCCCAGCACTGGGGAGAGGG - Exonic
953243317 3:41168610-41168632 AGGGCCCTGCACCTGGGGGATGG - Intergenic
953495042 3:43378661-43378683 AGGGCCCTGCTCTGGGGGGAAGG - Intronic
954812577 3:53257067-53257089 AGAGCCCTGCACAGGGGATGGGG + Intergenic
954851644 3:53605959-53605981 TGAGCACAGCTCTGGGGAGATGG + Intronic
954921030 3:54191152-54191174 ACATTCCTGCTCCGGGGAAATGG + Intronic
955950649 3:64239230-64239252 AGAGCCCTGCTGGGGGGCGGGGG + Intronic
959227369 3:103603081-103603103 AGAGTCCTGCTCCCCAGAGAAGG + Intergenic
960947770 3:122978610-122978632 AGAACGCTGGTCCTGGGAGATGG - Intronic
960955451 3:123027683-123027705 AGAGCCCAGCTCCGCCGAGCCGG - Intronic
961681706 3:128604036-128604058 AGGGCCCTGCTCCTGTCAGATGG - Intergenic
962422709 3:135242145-135242167 AGAGGCCTGGTCCCTGGAGAGGG - Intronic
968051580 3:195658303-195658325 AGAGCCCTGGGCCGGTGCGAGGG + Intergenic
968094885 3:195921866-195921888 AGAGCCGTGTTCCTGGGTGACGG - Intergenic
968104236 3:195990030-195990052 AGAGCCCTGGGCCGGTGCGAGGG - Intergenic
968302537 3:197627620-197627642 AGAGCCCTGGGCCGGTGCGAGGG - Intergenic
968734909 4:2290284-2290306 AGACCCCAGCTCCTCGGAGAAGG - Intronic
969489732 4:7492157-7492179 GCAGCCCTGCTCTGGAGAGAGGG - Intronic
970443979 4:16108885-16108907 ATAGCCCCGCTTGGGGGAGAAGG - Intergenic
970488101 4:16544551-16544573 GGAGCCATGTTCCTGGGAGAAGG + Intronic
971172361 4:24246753-24246775 AGAACCCAGCTCCCGGAAGATGG - Intergenic
972663881 4:41145167-41145189 AGGGCCCTGCTCCTGTGAGTAGG - Intronic
981586766 4:146311735-146311757 AGAGCCCAGCCCTGGGGAAAGGG + Intronic
982240477 4:153295231-153295253 AGTGCCCTCCACCGGCGAGAAGG - Intronic
984902990 4:184601201-184601223 GGTGCTCTGTTCCGGGGAGATGG - Intergenic
984950582 4:185004796-185004818 AGAGCCGGGCTCCGTGGAGCAGG - Intergenic
985125839 4:186693557-186693579 AGGGCCCTGCTCCCAGGAGGTGG - Intronic
985497502 5:218064-218086 CGGGCCCTGTTCCGGGGAGGTGG - Intronic
985497643 5:218556-218578 AGAGCCCTGGGCCGGTGCGAGGG + Intronic
985913258 5:2898907-2898929 AGGGCCCTGCTCAGGACAGATGG + Intergenic
988069311 5:26266718-26266740 AGATCCCTGCTCAGTGCAGAGGG + Intergenic
991245673 5:64506344-64506366 AGCGCCCAGCTCCCGGGACAGGG + Exonic
991411635 5:66351901-66351923 AGAGTCCTGTTCTGGGGTGAGGG + Intergenic
991987851 5:72308289-72308311 AGGGCACGGCTCAGGGGAGACGG + Intronic
992561531 5:77957679-77957701 GGCCCCCAGCTCCGGGGAGATGG - Intergenic
993757587 5:91750830-91750852 AGTGCTCTGTCCCGGGGAGATGG + Intergenic
996595749 5:125200785-125200807 GCAGCCCTGCTGCGGGGAGCTGG + Intergenic
997634844 5:135397867-135397889 AGCTCCCTGCTCCAGGGAGTCGG - Intronic
998005011 5:138651076-138651098 GGAGCCCTGGCCTGGGGAGAGGG - Intronic
999124116 5:149234009-149234031 AGTGCTCTGCTCTGGGGAAATGG + Intronic
999243689 5:150141957-150141979 AGGGCCATGCTGCAGGGAGAGGG + Intronic
1002312600 5:178323705-178323727 AGCGCCCTGCTCCAGGGAGAAGG - Intronic
1002567215 5:180118889-180118911 AGAGGGCTGCTCCTGGGACAGGG + Intronic
1002764537 6:227640-227662 ACAGCCATGCTCCAGGGAGCTGG - Intergenic
1003178496 6:3771822-3771844 TGAGCCCTGCCCCGCGGGGAGGG - Intergenic
1004429791 6:15533156-15533178 CATGCCCTGCTCTGGGGAGAGGG + Intronic
1006360558 6:33584803-33584825 TGAGCCCTCCACCAGGGAGAAGG + Intergenic
1006448450 6:34092579-34092601 CGTGCCCTGCTCAGAGGAGATGG + Intronic
1010703345 6:79077908-79077930 AGAGCTCTGCGCGGGAGAGAGGG + Exonic
1012912758 6:105136712-105136734 AGCGCCCAGACCCGGGGAGAAGG + Intronic
1012949548 6:105503435-105503457 AAAGCCCTGCCCTGGGGCGAAGG - Intergenic
1013003348 6:106046702-106046724 AGGGCTCTGCGCTGGGGAGAGGG + Intergenic
1017377693 6:153790054-153790076 AGAACCCTGCTTCGGGGTGCAGG + Intergenic
1017981723 6:159406661-159406683 AGAGACTTGCACTGGGGAGAGGG + Intergenic
1018788524 6:167128077-167128099 AGAGTCCTTCTCCCTGGAGACGG - Intronic
1019320916 7:414891-414913 TGAGGCCTGTTCCAGGGAGAGGG - Intergenic
1022530347 7:31063092-31063114 AGAGCCGTGCTGCAGGGAGCTGG + Intronic
1023877168 7:44293101-44293123 AGGGCGCTGCCCCTGGGAGAGGG - Intronic
1024675115 7:51631231-51631253 AGAGCCCCATTCCCGGGAGAGGG - Intergenic
1029350509 7:100009956-100009978 AGTGCCCTGCTAGGGGCAGAAGG + Intergenic
1029543108 7:101196161-101196183 AGTGCCCACCTCCGGGGGGACGG - Intronic
1029591734 7:101511507-101511529 AGAGCCCTGCTCTAGGCTGAAGG + Intronic
1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG + Exonic
1032192028 7:129770882-129770904 AGAGCCCTGCCCCTGGGCGCTGG + Intergenic
1034339024 7:150340686-150340708 CGCGCCCTGCTCTGGGGGGAGGG + Exonic
1035078757 7:156199119-156199141 ATACCCCTGCCCCGGGGTGAAGG + Intergenic
1036245265 8:7110778-7110800 AGCCCCCTGCTGTGGGGAGAAGG + Intergenic
1040577671 8:48667893-48667915 AGAACCTTGCTTCAGGGAGAAGG - Intergenic
1041526551 8:58812697-58812719 AGACCCCTGCCCCGTGGAGTTGG - Intronic
1041711460 8:60898482-60898504 AGAGCTCTGCCCGGGGGAAACGG - Intergenic
1046670908 8:117055144-117055166 TGAGCTCTGCTCCCTGGAGAGGG - Intronic
1047505563 8:125476894-125476916 AGAGCCCAGCCCAGGGGAGTAGG + Intergenic
1047526334 8:125637509-125637531 AAAGCCCTTCTCCTGGGAGAGGG + Intergenic
1049014387 8:139909232-139909254 AGAGCCCATCTCCGGGGAAGGGG - Intronic
1049213321 8:141396578-141396600 CGAGCCCTGCCCCGAGGAGCTGG + Intronic
1049233129 8:141494526-141494548 AGAGACCTCCTTTGGGGAGAGGG + Intergenic
1049593420 8:143472736-143472758 AGGGCCCCGGTGCGGGGAGACGG + Intronic
1052096548 9:24391104-24391126 AGTGCTCTGTTCCAGGGAGATGG + Intergenic
1053509368 9:38674202-38674224 AGAGCCATGCTTCGGGCATAAGG + Intergenic
1056305164 9:85283264-85283286 TGAACCATGCTCTGGGGAGATGG - Intergenic
1056529977 9:87478577-87478599 AAAGCCCTGCTCCCAGGAGAGGG - Intergenic
1057191411 9:93089900-93089922 AGAGGCCTGAACCGGGGCGAGGG - Intergenic
1057903866 9:98969581-98969603 AGAGCCCCGCTCCTGGTAGCTGG + Intronic
1058920674 9:109611723-109611745 TGAGCCCTGCTCTTGGGACAGGG + Intergenic
1059744317 9:117185356-117185378 CCAGCCCTGCTCTGGGCAGATGG + Intronic
1060400261 9:123344525-123344547 AGTGCCCTGCTCCGGGAACTGGG - Intergenic
1060719179 9:125963368-125963390 AGTGCTGTGCTCCAGGGAGACGG + Intronic
1060810752 9:126610454-126610476 AGAGCCGTGCTCGAGGGAGGCGG + Intergenic
1060894491 9:127209003-127209025 AGGGCCCTGCTCTGGGAAGGGGG + Intronic
1061623007 9:131823954-131823976 AGAGCCCGGCGCCGGCGAGTTGG + Intergenic
1185633213 X:1531725-1531747 AGTGCCCTGCTCCAGGGGAAAGG - Intronic
1186921956 X:14292082-14292104 GAAGCCCTCCTCTGGGGAGAAGG - Intergenic
1187239515 X:17499877-17499899 AGAGCCCTGCACCCAGGACAGGG - Intronic
1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG + Exonic
1188251494 X:27901239-27901261 CGAGCACTGCTCCTGGGAGATGG - Intergenic
1192559172 X:72114344-72114366 AGAGGCCTGCTCCAGAGAGGAGG - Intergenic
1198214898 X:134546484-134546506 ACAGCCCTGCTGCGTGGACAAGG + Intergenic
1201546809 Y:15174300-15174322 AGAGCCCTGATCCTGGTATAGGG + Intergenic
1201633753 Y:16099120-16099142 AGTGCTCTGTTCCAGGGAGATGG - Intergenic