ID: 1030615627

View in Genome Browser
Species Human (GRCh38)
Location 7:111735135-111735157
Sequence CACCCCTAGCAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030615627_1030615632 -9 Left 1030615627 7:111735135-111735157 CCAGGCTCCAGCTGCTAGGGGTG 0: 1
1: 0
2: 2
3: 26
4: 220
Right 1030615632 7:111735149-111735171 CTAGGGGTGGGGTTCACAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 185
1030615627_1030615635 20 Left 1030615627 7:111735135-111735157 CCAGGCTCCAGCTGCTAGGGGTG 0: 1
1: 0
2: 2
3: 26
4: 220
Right 1030615635 7:111735178-111735200 ATAACACAGCTAAAAACACACGG 0: 1
1: 0
2: 3
3: 29
4: 367
1030615627_1030615633 -5 Left 1030615627 7:111735135-111735157 CCAGGCTCCAGCTGCTAGGGGTG 0: 1
1: 0
2: 2
3: 26
4: 220
Right 1030615633 7:111735153-111735175 GGGTGGGGTTCACAGCTGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 269
1030615627_1030615634 -4 Left 1030615627 7:111735135-111735157 CCAGGCTCCAGCTGCTAGGGGTG 0: 1
1: 0
2: 2
3: 26
4: 220
Right 1030615634 7:111735154-111735176 GGTGGGGTTCACAGCTGGAAGGG 0: 1
1: 0
2: 2
3: 27
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030615627 Original CRISPR CACCCCTAGCAGCTGGAGCC TGG (reversed) Exonic
900763737 1:4489611-4489633 GCCACCTATCAGCTGGAGCCTGG + Intergenic
900843610 1:5078231-5078253 CACCACTAGCAGCTGGGGAGAGG + Intergenic
901156891 1:7146219-7146241 CACCCCTCGCAGCAGGAGCTTGG + Intronic
901377425 1:8849279-8849301 CACCCCTAGCAGGCGGATGCAGG + Intergenic
901438575 1:9264069-9264091 CAGCCGGAGCAGCTGGTGCCAGG + Exonic
901648173 1:10727764-10727786 CAGCCCTGGCAGCTGCTGCCTGG - Intronic
903173739 1:21568877-21568899 CACTCCAAGGAGCTGGAGCTTGG - Intronic
903332288 1:22602317-22602339 CACACCTGGAGGCTGGAGCCAGG + Exonic
903764833 1:25727515-25727537 CACCCCCAGCCTCTGGAGCCTGG - Intronic
903771443 1:25766912-25766934 CACACCTGGCAGCAGGAGGCTGG - Intronic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
906422260 1:45679480-45679502 GACCCCTGGCAGCTAGAGCTGGG - Intronic
907627351 1:56043272-56043294 CAGCCCTAGCAGCAGGGGACAGG - Intergenic
907777928 1:57536910-57536932 CATCCCCAGCATCTGGTGCCAGG - Intronic
912558481 1:110533395-110533417 CTGCCCTGGCATCTGGAGCCAGG - Intergenic
912956146 1:114155120-114155142 ATCCCCTAGCAGCTGGTGCCTGG + Intergenic
915315919 1:155029246-155029268 CTCCCCCTGCAGCTGGTGCCGGG + Exonic
915367333 1:155323531-155323553 CGCCCCCAGCAGCCGCAGCCCGG - Intronic
915839515 1:159203211-159203233 TACCCCTTGCACCTGGTGCCTGG + Intronic
919708095 1:200698158-200698180 CTCCCCCAGCAGCTGCAGTCAGG - Intergenic
919980065 1:202637480-202637502 CACCCCCAGCACATGGCGCCTGG - Intronic
920310821 1:205047282-205047304 CACCCCTGCCAGCTGCAGCCTGG + Intronic
920744765 1:208616420-208616442 CACCCCTGGCAGCAGTGGCCTGG + Intergenic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1066298250 10:34074977-34074999 CACTCCTAGCTGCAGGAGCAGGG - Intergenic
1067168475 10:43884384-43884406 CACCCCTTGCAGGTGGAACCAGG - Intergenic
1067293305 10:44959759-44959781 GGCCCCGAGCAGCTGAAGCCTGG + Intronic
1067642962 10:48068047-48068069 AACCCAGAGCAGCAGGAGCCAGG + Intergenic
1067755039 10:48998976-48998998 GACCCCCAGCAGCTGGGGCAGGG + Intergenic
1071524318 10:86349335-86349357 TACCGCCAGCACCTGGAGCCCGG + Intronic
1072189500 10:93068528-93068550 CACAGCTAGCAGCTGGAGCACGG - Exonic
1073146327 10:101284335-101284357 CTCCGCGCGCAGCTGGAGCCCGG + Intergenic
1074405310 10:113176343-113176365 CACCGCTAGCAGGTGGTGGCTGG - Intergenic
1075547792 10:123368496-123368518 CACCCAGAGCTGCTGCAGCCTGG - Intergenic
1075715576 10:124553348-124553370 CACCCCCTGCACCTGCAGCCAGG + Intronic
1076451656 10:130560799-130560821 CACCCCTACCTGCTGGACGCCGG + Intergenic
1076549392 10:131267992-131268014 CACTCCTGGCAGCTGGGCCCAGG - Intronic
1076572461 10:131441522-131441544 AACCCCCCGCAGCTGGAGGCAGG + Intergenic
1076605955 10:131689949-131689971 CACCTCCAGGAGCTGGACCCTGG + Intergenic
1076610860 10:131725234-131725256 TACCCCTCCAAGCTGGAGCCTGG - Intergenic
1076876759 10:133220045-133220067 CACATCCAGCAGCTGGAGACAGG + Exonic
1076995368 11:295019-295041 CACCCCGAGCTCCTGAAGCCGGG + Exonic
1077296818 11:1830244-1830266 CACCCTCATCAGCTGGGGCCCGG - Intronic
1077465688 11:2732783-2732805 CTCGCCTTGCAGCCGGAGCCTGG + Intronic
1078929993 11:15905531-15905553 CACCCCTGGAACCAGGAGCCAGG + Intergenic
1081707601 11:45193856-45193878 AACCCCCAGCAGCTGGAGTCCGG - Intronic
1081794623 11:45810971-45810993 CTCCCCGAGCAGCAGGAGCAGGG - Exonic
1081831770 11:46120957-46120979 CCCCCCTGGCAGCTGGAGGCAGG + Exonic
1081874738 11:46400906-46400928 CTGCCCTGGGAGCTGGAGCCGGG - Intronic
1082862114 11:57866797-57866819 CACAGCTACCAGCTGGAGACAGG + Intergenic
1084167692 11:67383669-67383691 CCTCCCAAGCTGCTGGAGCCTGG - Intronic
1084656465 11:70522638-70522660 CAGCCCGCGGAGCTGGAGCCGGG - Intronic
1084667972 11:70586741-70586763 CACGGCTCGCAGCTGGAGCCGGG + Intronic
1084681695 11:70670136-70670158 TTCCCAGAGCAGCTGGAGCCAGG + Intronic
1085388044 11:76168351-76168373 CACTTCCAGTAGCTGGAGCCTGG + Intergenic
1086075012 11:82841245-82841267 CCCCGCTGGCAGCTGGTGCCAGG - Intronic
1087007789 11:93486298-93486320 CACCCCAAGCAGCTGCTTCCAGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089563054 11:119355560-119355582 CTGCCCTGGGAGCTGGAGCCTGG - Exonic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1102440959 12:112963534-112963556 CACTCCTAGCAGCTGGGGATGGG - Intronic
1103096484 12:118136515-118136537 CACCCCGAGCACCGGGAACCCGG + Intronic
1103437364 12:120937244-120937266 CACTCCTAGCAGCTGGGGAATGG - Intergenic
1103884306 12:124189291-124189313 CACACCTGGTAGATGGAGCCTGG - Intronic
1103959489 12:124600045-124600067 CCCTCCTGGCAGCTGGGGCCTGG + Intergenic
1104590963 12:130084445-130084467 CACCCCTAGCCCAAGGAGCCAGG + Intergenic
1105813867 13:24016194-24016216 CACCCCTCACAGGAGGAGCCAGG - Intronic
1106979546 13:35261387-35261409 CATCCCTAGCAGCTGGACTACGG - Intronic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1113037120 13:106062413-106062435 CACCCTCAGCAGCTCTAGCCAGG + Intergenic
1113400605 13:109989256-109989278 CACCCCAGGGAGCTGGAGCTGGG - Intergenic
1113555400 13:111230025-111230047 TAGCCCCAGCTGCTGGAGCCTGG + Intronic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1113867470 13:113536665-113536687 CACCCCAAGCAGCTGGCAGCAGG - Intronic
1115307409 14:31946708-31946730 GAGCCCCAGCAGCTGGACCCTGG + Intronic
1122548754 14:102538968-102538990 CCCCAATAGCAGCTGGGGCCAGG - Intergenic
1123010842 14:105348862-105348884 GGCCCCAAGCACCTGGAGCCAGG + Intronic
1124644409 15:31426839-31426861 CACCCCAGGCAGCTGGGGTCTGG + Intronic
1124952618 15:34337727-34337749 CACCCGCATCAGCTGGCGCCGGG - Exonic
1125723361 15:41855732-41855754 CACCCCCAGCTCCTGGAGGCGGG - Exonic
1127810452 15:62560872-62560894 CAACCGAGGCAGCTGGAGCCAGG + Intronic
1128078672 15:64843389-64843411 CAGCCCTTGCAGCAGGGGCCTGG - Intronic
1128715302 15:69903501-69903523 CTCCCCTAGCAGCAGTAGCAGGG + Intergenic
1129112757 15:73347470-73347492 CAGCCCTAGCATCAGGAGCATGG - Intronic
1129152435 15:73697331-73697353 CACCCCCAGCAGCTGGGCCAAGG - Intronic
1129257013 15:74339397-74339419 CAGCCCTAGCTGCAGCAGCCTGG + Intronic
1129384963 15:75191381-75191403 GAACCCCAGCAGCAGGAGCCAGG - Intergenic
1130146114 15:81274962-81274984 CAGTCCTTGGAGCTGGAGCCTGG - Intronic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1132033453 15:98458319-98458341 CCCCAGTACCAGCTGGAGCCTGG + Intronic
1135424197 16:22324257-22324279 CAGGCCTGGGAGCTGGAGCCTGG - Intronic
1138975337 16:62200084-62200106 CACCCAGAGCAGCTGGTGCAAGG - Intergenic
1141067749 16:80927611-80927633 CACCTCTGGCATCTGTAGCCAGG - Intergenic
1141761993 16:86034588-86034610 AGCCACTAGCAGCTGGAGCGAGG + Intergenic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1144608800 17:16690475-16690497 GACCCCTAGCGTCGGGAGCCAGG + Exonic
1144704964 17:17362279-17362301 CACCCCCAGCTGCAGGACCCTGG - Intergenic
1144739971 17:17576304-17576326 CACCCCTCGGTGCTGGTGCCCGG + Intronic
1146677943 17:34786210-34786232 AAGCCCAAGCAGCTGGACCCAGG + Intergenic
1146843450 17:36169549-36169571 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146855759 17:36257487-36257509 CACCGATGGCAGCAGGAGCCTGG + Intronic
1146864862 17:36330888-36330910 CACCGATGGCAGCAGGAGCCCGG - Intronic
1146871665 17:36381398-36381420 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146879024 17:36432480-36432502 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146882965 17:36453626-36453648 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1147067721 17:37931482-37931504 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147074551 17:37982022-37982044 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147079252 17:38011037-38011059 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147086074 17:38061561-38061583 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147095191 17:38134979-38135001 CACCGATGGCAGCAGGAGCCCGG - Intergenic
1147102019 17:38185526-38185548 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1147536374 17:41325303-41325325 CACCAAGGGCAGCTGGAGCCTGG - Intergenic
1147615396 17:41824419-41824441 CATAGCTAGGAGCTGGAGCCAGG - Intergenic
1149846610 17:60012036-60012058 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1149993133 17:61393799-61393821 CACCCCCTGCTGCTGGGGCCAGG - Intergenic
1151509141 17:74547568-74547590 CAACCCTGTCGGCTGGAGCCAGG - Intergenic
1151554166 17:74838127-74838149 CTGCCCTGGCAGCTGAAGCCTGG + Exonic
1152091375 17:78249581-78249603 CATCCCTGGCAGCTGGCCCCAGG - Intergenic
1152114783 17:78378836-78378858 CAGCCCTCGCGGCTGCAGCCCGG + Intronic
1152284264 17:79403300-79403322 CACCCCTACCAGGTGGGGCCAGG + Intronic
1153006858 18:504764-504786 CACCCCCAGAAGCAGCAGCCAGG + Intergenic
1155476078 18:26236954-26236976 CTCCCGTAGCCGCTGGAGCAAGG + Intronic
1157580856 18:48773472-48773494 CACCCCCACCAGCCAGAGCCAGG + Intronic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1161210297 19:3062244-3062266 CGCCCCCAGCAGCCCGAGCCGGG - Intronic
1161632821 19:5367437-5367459 CACCCATAGCAGCTGAAGCCAGG - Intergenic
1162842874 19:13369158-13369180 CATCCATAGCAGCTGGAGGGCGG - Intronic
1163394190 19:17049443-17049465 CAGCCCCAGAAGCTGGGGCCAGG + Intergenic
1167697957 19:51026033-51026055 CACCCCAAGCTGCTGGGGCCTGG - Intronic
1167792715 19:51691160-51691182 TCCCCCTCGCAGCTCGAGCCAGG - Intergenic
1168401150 19:56086995-56087017 CTCCCCCAGAAGCTGGAGGCAGG + Intergenic
1168492998 19:56826176-56826198 CACACCAATCATCTGGAGCCTGG - Intronic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926143474 2:10382777-10382799 CACACTCAGCAGCTGCAGCCGGG - Intronic
927695896 2:25239635-25239657 CACCCATACTCGCTGGAGCCTGG - Intronic
927871994 2:26629586-26629608 CACCCCTTGCAGCAGGAGACAGG - Intronic
928251747 2:29686851-29686873 TACAACTAGCAGCTGGAGCTTGG - Intronic
930091627 2:47535212-47535234 CACACCTTTCAGCTGCAGCCAGG + Intronic
931464338 2:62473552-62473574 CACTCCCAGCAGCTGAAGCAGGG - Intergenic
935203477 2:100878199-100878221 TTTCCCTAGCATCTGGAGCCAGG - Intronic
937297627 2:120819117-120819139 CAACTCTACCAGCTGCAGCCAGG - Intronic
937872508 2:126796268-126796290 CCCACATAGCAGCTGGAGCCTGG + Intergenic
938317306 2:130339130-130339152 AAACTCAAGCAGCTGGAGCCTGG - Exonic
942326857 2:174783022-174783044 CTCCCCTAGGAGCTGGATCTAGG + Intergenic
947743722 2:232496994-232497016 GACCCCTGGCAGCAGGCGCCTGG + Intergenic
948089441 2:235280360-235280382 TGACCCTAGCAGCTGGAGCCTGG + Intergenic
948513820 2:238490349-238490371 CACACCTGGAAGCTTGAGCCTGG - Intergenic
948702604 2:239769708-239769730 CACCCCTGCCAGCTGGGGCTGGG + Intronic
948818114 2:240523856-240523878 CACCCCCACCAGCTGGTGCCAGG + Intronic
948894002 2:240919865-240919887 CAGGTCCAGCAGCTGGAGCCTGG + Intronic
1170509818 20:17065088-17065110 CACCCACAGCAGCTGGAGAATGG - Intergenic
1171460553 20:25295679-25295701 CTCCCCTAGCCTCTGGACCCAGG - Intronic
1172881187 20:38200967-38200989 CTATCCTAGCAGCTGCAGCCAGG + Intergenic
1173360524 20:42340380-42340402 AACCCTAAGCAGCTGTAGCCAGG + Intronic
1173769291 20:45644462-45644484 CCCCCCAAGCAGCTGGAGCTGGG + Intergenic
1176177822 20:63737034-63737056 CACCCGGAGGAGCTGGAGGCTGG - Intronic
1176389908 21:6158121-6158143 CACCCCCAGAAGCTGCAGTCAGG - Intergenic
1178468254 21:32868955-32868977 GGCCCCTCGCAGCAGGAGCCTGG + Intergenic
1179551376 21:42146083-42146105 CAGCCCTAGGAGCTGGTGCTGGG + Intergenic
1182103618 22:27673886-27673908 CACCCCTCTAAGCTGGAGCCAGG - Intergenic
1182846875 22:33438623-33438645 CCTCCCGAGCAGCAGGAGCCGGG - Intronic
1183547399 22:38461817-38461839 CACCCCTCGCCGCTGGCGACAGG - Intergenic
1183606264 22:38868222-38868244 AACCCCAAGCAACTGGTGCCTGG - Intronic
1183645529 22:39124015-39124037 CACCCCAAGAAGGTGGAGCAGGG - Intronic
1184024104 22:41841155-41841177 CACCCCTAGGAGGTGGAGGTGGG + Intronic
1184660609 22:45963945-45963967 CACCTCCAGGAGCTGCAGCCTGG + Intronic
1184800421 22:46755595-46755617 CACCCCTTGCACCAGGATCCAGG - Intergenic
1184805545 22:46792912-46792934 CTCCACCAGCTGCTGGAGCCCGG + Intronic
949384821 3:3489531-3489553 AACCCCTAGCAGCTACAGCAAGG + Intergenic
950430501 3:12948262-12948284 AAGCCCCAGCAGCTGGAGGCAGG + Intronic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
954538596 3:51379459-51379481 AGCCCCCAGCAGCTGGAGTCTGG + Intronic
954797337 3:53168264-53168286 CACCCATGGCAGCTGGGGGCAGG + Intronic
955911694 3:63864274-63864296 CACCCCTAGCAGCGTCACCCTGG - Intergenic
959762181 3:109978241-109978263 CACCCTTAGCAGCAGAGGCCTGG - Intergenic
963110352 3:141683141-141683163 CCCTCCCAGGAGCTGGAGCCTGG - Intergenic
966688693 3:182722918-182722940 CAGCCTGAGCCGCTGGAGCCGGG + Intergenic
968731407 4:2270973-2270995 AACCCCTGGCAGCTGGGGCTGGG - Intronic
969455853 4:7299197-7299219 GCCCCCTGGCAGCCGGAGCCAGG + Intronic
970364923 4:15348990-15349012 CACCCCTAGAAGGTGGTGCTAGG + Intronic
985208672 4:187568615-187568637 AACCCATAGCTGCTGGACCCAGG + Intergenic
985579802 5:690610-690632 CACCCATCGCAGATGGAGACTGG - Intronic
985594648 5:782669-782691 CACCCATCGCAGATGGAGACTGG - Intergenic
985942502 5:3150006-3150028 CACCCATAGGAGCGGGAGGCCGG + Intergenic
986123717 5:4866706-4866728 CTCCACGAGCAGCTGGAGCCCGG - Intergenic
986384432 5:7217799-7217821 CACCCAGAGGAGCTGCAGCCTGG - Intergenic
988729574 5:33958066-33958088 CACCACTGTCAGCTGGAGACTGG + Intronic
992299149 5:75359974-75359996 AACACCTAGCATCTGTAGCCAGG - Exonic
992529180 5:77638874-77638896 CAGCCCTGGCAGCTCCAGCCCGG + Exonic
998381986 5:141732179-141732201 CACACCTAGCAGATAGAGCCTGG + Intergenic
1000056301 5:157609491-157609513 CAACCCTAGGAGCTGATGCCTGG + Intergenic
1000133403 5:158321307-158321329 AACCCCTGGCAGCTGGAGAGTGG + Intergenic
1001495912 5:172187785-172187807 CAGCCCTCGGAGCCGGAGCCAGG + Intronic
1002058980 5:176615225-176615247 CACCCCCAGCAGCTGCGGCCCGG + Intergenic
1004321643 6:14636016-14636038 CACCCCCAGCAGGTGAAGGCTGG + Intergenic
1005948653 6:30614765-30614787 CACCCCTGGCAGCTGAAGTGGGG + Intronic
1007708009 6:43803240-43803262 CACCCCTCCCAGCTGGGCCCAGG + Intergenic
1011135622 6:84096870-84096892 CATCCCTAGCAGCTGGGAACAGG + Intergenic
1011217315 6:85018675-85018697 CACCACTTGCAGTTGCAGCCAGG - Intergenic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014310336 6:119792156-119792178 GACCCCTAGCACCCAGAGCCAGG + Intergenic
1015804542 6:137095195-137095217 GACCCCTGGCTGCTGGAGCATGG + Intergenic
1017705380 6:157117933-157117955 TAGCCCTTGCACCTGGAGCCTGG + Intronic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1021784170 7:24135800-24135822 CTTCCCTAGGAGATGGAGCCCGG - Intergenic
1022533360 7:31080706-31080728 CAATCCCAGCAGCCGGAGCCTGG - Intronic
1026390423 7:69896054-69896076 CAACACTAGCAGAGGGAGCCAGG - Intronic
1026680850 7:72465521-72465543 CACCCCTGACTGCTGCAGCCAGG + Intergenic
1029481930 7:100818585-100818607 CTCACCCAGCAGCTTGAGCCTGG - Exonic
1030615627 7:111735135-111735157 CACCCCTAGCAGCTGGAGCCTGG - Exonic
1031919034 7:127588288-127588310 CTCCCCTAGGAGCCAGAGCCGGG + Intronic
1032666611 7:134043314-134043336 CACCCCTACCAAATGCAGCCAGG - Intronic
1034898147 7:154890706-154890728 CACCCCATGCATCTGGAGCCAGG + Intronic
1035592037 8:823669-823691 CATCTCTGGCAGCTGGAGGCAGG - Intergenic
1039062369 8:33581824-33581846 CCCACCCAGCAACTGGAGCCAGG - Intergenic
1039776699 8:40744299-40744321 CACCCCTAGCAGGAGCAGACTGG - Intronic
1039853875 8:41396241-41396263 CCAGCCAAGCAGCTGGAGCCGGG + Intergenic
1039881701 8:41629232-41629254 CACGCCGAGCAGCAGGAACCGGG - Intergenic
1041105892 8:54443751-54443773 CACAGCTATCACCTGGAGCCAGG - Intergenic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1042726991 8:71889237-71889259 TACCCCTAGCAGTGGTAGCCTGG - Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1045005322 8:97912396-97912418 CAGCGAGAGCAGCTGGAGCCGGG + Intronic
1046058014 8:109101394-109101416 CACCCCTTGGAGCGAGAGCCAGG + Intronic
1048330530 8:133467666-133467688 CACCCCTTGCCCCTGGGGCCCGG - Intronic
1049182173 8:141228533-141228555 CACTCCCCGCAGCTGGAGCATGG + Exonic
1049235420 8:141510145-141510167 CTCCCCTAGCAGCTGCGGCCTGG + Intergenic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1057906483 9:98987402-98987424 CAACCCCAGCAGCCGCAGCCTGG + Intronic
1058045588 9:100353361-100353383 CACACCTAGTATCTAGAGCCTGG + Intergenic
1058783785 9:108365634-108365656 CACCCCTTCCAGCAGGAGCTTGG + Intergenic
1060348748 9:122839051-122839073 CTCCCCTACCAGCTGGAGATGGG + Intergenic
1060404969 9:123368602-123368624 CACCACTATCAGCGGGAACCCGG + Intronic
1062597853 9:137307133-137307155 GACCCCTGCCAGCTGCAGCCGGG + Exonic
1186256870 X:7731261-7731283 CCTCCCTAGCAGCTGGAACTAGG + Intergenic
1186396204 X:9211531-9211553 CATCGCTAGCAGCTGGGGCTTGG - Intergenic
1186515207 X:10161687-10161709 CACCCCTGGCAGCTGCAACTTGG + Intronic
1189180626 X:39001350-39001372 GCCCCCTATCAGCTGGAACCAGG - Intergenic
1189270710 X:39749868-39749890 CACTCCTAGCAGTGGGAGGCTGG - Intergenic
1190215744 X:48478477-48478499 AGCCCCAGGCAGCTGGAGCCAGG + Exonic
1194583437 X:95704798-95704820 CACCCCCAGCACCTTCAGCCTGG + Intergenic
1195559962 X:106271927-106271949 GACCCCTAGAAGCTAGAGCCTGG + Intergenic
1195562000 X:106294412-106294434 GACCCCTAGAAGCTAGAGCCTGG - Intergenic
1195998907 X:110760176-110760198 CATCCCTAGCAGGTGGATCCTGG + Intronic
1196586510 X:117435506-117435528 CACCCCTAGCAGGGGTGGCCTGG + Intergenic
1199555327 X:149101841-149101863 AGCCTCTGGCAGCTGGAGCCTGG - Intergenic
1199978806 X:152909570-152909592 CACCCCTGGAAGCAGGAGGCCGG - Intergenic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic
1200418232 Y:2935355-2935377 CCGCCCTACCAGCCGGAGCCCGG + Intronic