ID: 1030616620

View in Genome Browser
Species Human (GRCh38)
Location 7:111744143-111744165
Sequence GTGGTGCACATCCCATACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 977
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 932}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030616620_1030616624 -2 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616624 7:111744164-111744186 ACTGAGAAGGTAGCAACCTTGGG No data
1030616620_1030616627 19 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616627 7:111744185-111744207 GGCCAAGTGGCTCTCTGCAGTGG No data
1030616620_1030616629 22 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG No data
1030616620_1030616623 -3 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616623 7:111744163-111744185 CACTGAGAAGGTAGCAACCTTGG 0: 1
1: 0
2: 0
3: 16
4: 178
1030616620_1030616625 6 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616625 7:111744172-111744194 GGTAGCAACCTTGGGCCAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030616620 Original CRISPR GTGGTGCACATCCCATACTG AGG (reversed) Intronic
904253085 1:29238277-29238299 GTGTTCCACATCCCACCCTGAGG + Intronic
904632417 1:31852361-31852383 GTGGGGAACATCACACACTGGGG - Intergenic
905006961 1:34717536-34717558 GAGGGGAACATCACATACTGGGG - Intronic
905045922 1:35000924-35000946 GTGGTGCACAGGCCATAGTTTGG - Intronic
905051421 1:35054307-35054329 GTGGGGAACATCACACACTGGGG - Intergenic
906569594 1:46825308-46825330 GTGGGGAACATCACACACTGGGG - Intergenic
906796828 1:48702933-48702955 GAGATGCACATCCCACAGTGAGG + Intronic
906834428 1:49067927-49067949 GTGGGGAACATCACACACTGGGG - Intronic
907232241 1:53010598-53010620 GTGGGGAACATCACACACTGGGG + Intronic
907295792 1:53452739-53452761 GTGTTGCAAATCCCAAAGTGTGG - Intergenic
907696437 1:56734633-56734655 GTGGGGAACATCACACACTGGGG + Intronic
908215655 1:61949034-61949056 GTGGGGAACATCACACACTGGGG + Intronic
908257303 1:62313670-62313692 GAGGGGAACATCACATACTGGGG + Intronic
908500689 1:64741002-64741024 GTGGGGAACATTACATACTGGGG + Intergenic
908904426 1:68991772-68991794 GAGGGGAACATCACATACTGGGG + Intergenic
908920820 1:69189269-69189291 GTGGGGAACATCACACACTGGGG - Intergenic
908937131 1:69389619-69389641 GTGGGGAACATCACACACTGGGG - Intergenic
909807373 1:79888729-79888751 GTGGGGAACATCACACACTGGGG - Intergenic
909816799 1:80004515-80004537 GTGGGGAACATCACACACTGGGG - Intergenic
910452879 1:87364763-87364785 GAGGGGAACATCACATACTGGGG - Intergenic
910645525 1:89510123-89510145 GTGGGGAACATCACACACTGGGG - Intergenic
911009939 1:93269246-93269268 GTGGGGAACATCACACACTGGGG + Intronic
911146696 1:94559354-94559376 GTGGGGAACATCACACACTGGGG + Intergenic
911535830 1:99099019-99099041 GAGGGGAACATCACATACTGGGG - Intergenic
911772711 1:101767234-101767256 GTGGGGAACATCACACACTGGGG + Intergenic
911810084 1:102265034-102265056 GTGGGGTACATCACACACTGGGG + Intergenic
911927316 1:103851198-103851220 GTGGGGAACATCACACACTGGGG - Intergenic
911943291 1:104073844-104073866 GAGGAGCATCTCCCATACTGGGG - Intergenic
912026690 1:105183975-105183997 GTGGGGAACATCACACACTGGGG - Intergenic
912029224 1:105218516-105218538 GTGGGGAACATCACACACTGGGG - Intergenic
912226311 1:107738175-107738197 GTGGGGAACATCACACACTGGGG + Intronic
912518892 1:110232120-110232142 GTGGTAGACATCCCAGGCTGAGG + Intronic
912605316 1:110983474-110983496 GTGGGGAACATCACATACTGGGG - Intergenic
912742880 1:112217614-112217636 GTGGGGAACATCACACACTGGGG + Intergenic
913421833 1:118678624-118678646 GTGGGGAACATCACACACTGGGG - Intergenic
913506909 1:119525622-119525644 GTGGGGAACACCACATACTGGGG + Intergenic
913649915 1:120903508-120903530 GTGGGGAACATCACACACTGGGG + Intergenic
914076767 1:144360003-144360025 GTGGGGAACATCACACACTGGGG - Intergenic
914102411 1:144606494-144606516 GTGGGGAACATCACACACTGGGG + Intergenic
914171214 1:145225579-145225601 GTGGGGAACATCACACACTGGGG - Intergenic
914296485 1:146330704-146330726 GTGGGGAACATCACACACTGGGG - Intergenic
914526323 1:148469552-148469574 GTGGGGAACATCACACACTGGGG - Intergenic
914640077 1:149597565-149597587 GTGGGGAACATCACACACTGGGG + Intergenic
915695540 1:157737971-157737993 GAGGGGAACATCACATACTGGGG + Intergenic
915990385 1:160509474-160509496 GTGGGGAACATCACACACTGGGG + Intronic
916372611 1:164116501-164116523 GTGGAGAACATCACACACTGGGG - Intergenic
916635785 1:166667138-166667160 GTGGGGAACATCACACACTGGGG + Intergenic
917037332 1:170763218-170763240 GTGGGGAACATCACACACTGGGG + Intergenic
917172271 1:172190183-172190205 GTGGGGAACATCACACACTGGGG - Intronic
917192947 1:172437554-172437576 GTGGGGAACATCACACACTGGGG + Intronic
917270867 1:173272167-173272189 GTGGGGAACATCACACACTGGGG + Intergenic
917331078 1:173881125-173881147 GTGGGGAACATCACACACTGGGG - Intronic
917579589 1:176361804-176361826 GTGGGGAACATCACACACTGGGG + Intergenic
917744217 1:177992003-177992025 GTGGGAAACATCACATACTGGGG + Intergenic
917893212 1:179460213-179460235 GTGGGGAACATCACATACCGAGG - Intronic
917903386 1:179565742-179565764 GCGGTGAACATCACACACTGGGG - Intronic
918088515 1:181266143-181266165 GTGGGGAACATCACACACTGGGG - Intergenic
918286997 1:183066775-183066797 GAGGGGAACATCACATACTGGGG + Intronic
918467330 1:184834029-184834051 GTGGGGAACATCACACACTGGGG - Intronic
918536140 1:185576787-185576809 GTGGTGAACAACACACACTGGGG - Intergenic
918722677 1:187873817-187873839 GTGGGGAACATCACACACTGGGG - Intergenic
918780231 1:188690485-188690507 GTGGGGAACATCACACACTGGGG - Intergenic
918947236 1:191083131-191083153 GAGGGGAACATCACATACTGGGG - Intergenic
919042865 1:192414065-192414087 GTGGGGAACATCACATACTGGGG + Intergenic
919309639 1:195891862-195891884 ATGGTGAACATCACACACTGGGG - Intergenic
919391063 1:196986539-196986561 GTGGGGAACATCACACACTGGGG - Intronic
920589334 1:207201888-207201910 GTGGGGAACATCACACACTGGGG + Intergenic
920642839 1:207770573-207770595 GTGGGGAACATCACACACTGGGG - Intronic
921038131 1:211402462-211402484 GTGGGGAACATCACACACTGGGG - Intergenic
921239221 1:213160819-213160841 GTGGGGAACATCACACACTGGGG + Intronic
921830993 1:219727437-219727459 GTGGGGAACATCACACACTGGGG - Intronic
921980900 1:221257624-221257646 GTGGGGAACATCACACACTGGGG - Intergenic
922412125 1:225387207-225387229 GTGGGGAACATCACACACTGGGG + Intronic
922643109 1:227256291-227256313 GAGGGGCACATCACACACTGGGG + Intronic
923240691 1:232082673-232082695 GTGGGGAACATCACACACTGGGG + Intergenic
923431163 1:233921816-233921838 GTGGGGAACATCACACACTGGGG - Intronic
924398345 1:243649584-243649606 GAGGGGAACATCACATACTGGGG - Intronic
924873530 1:248075043-248075065 GTGGGGAACATCACACACTGGGG - Intronic
1063132101 10:3187212-3187234 GTGGGGAACATCACACACTGGGG - Intergenic
1063591160 10:7396867-7396889 GTGGGGAACATCACACACTGGGG + Intronic
1063712603 10:8494124-8494146 GAGGTGAACATCACATATTGGGG + Intergenic
1064260929 10:13785792-13785814 GTGGGGAACATCACATACTGGGG - Intronic
1064510962 10:16091013-16091035 GTGGGGAACATCACACACTGAGG + Intergenic
1064556032 10:16547949-16547971 GAGGGGAACATCACATACTGGGG - Intergenic
1064975697 10:21112559-21112581 GTGGGGAACATCACACACTGGGG + Intronic
1065451005 10:25856784-25856806 GTGGGGAACATCACACACTGGGG - Intergenic
1065472547 10:26097557-26097579 GTGGGGAACATCACACACTGGGG - Intronic
1065502609 10:26397130-26397152 GTGGGGAACATCACACACTGGGG + Intergenic
1066112295 10:32208026-32208048 GTGGGGAACATCACACACTGGGG - Intergenic
1066177016 10:32918164-32918186 GTGGGGAACATCACACACTGGGG + Intronic
1066291857 10:34021715-34021737 GTGGGGAACATCACACACTGGGG - Intergenic
1066751786 10:38665145-38665167 GTGGGGTACATCACACACTGGGG + Intergenic
1066965254 10:42257946-42257968 GTGGGGAACATCACACACTGGGG - Intergenic
1067193882 10:44096866-44096888 GTGGGGAACATCACACACTGGGG + Intergenic
1067202974 10:44190316-44190338 GTGGGGAACATCACACACTGGGG + Intergenic
1068018170 10:51544226-51544248 GTGGGGAACATCACACACTGGGG - Intronic
1068460707 10:57324705-57324727 GTGGGGGACATCACACACTGGGG + Intergenic
1069028730 10:63572492-63572514 GAGGGGAACATCACATACTGGGG - Intronic
1069260457 10:66387915-66387937 GTGGGGAACATCACACACTGGGG + Intronic
1069354195 10:67564463-67564485 GTGGGGAACATCACACACTGGGG + Intronic
1069355369 10:67579224-67579246 GTGGGGAACATCACACACTGGGG - Intronic
1069361210 10:67643704-67643726 GAGGGGAACATCACATACTGGGG - Intronic
1069579142 10:69553296-69553318 GTGCTCCACTTCCCATAGTGGGG - Intergenic
1071976707 10:90962964-90962986 GTGGGGAACATCATATACTGGGG - Intergenic
1072045428 10:91650106-91650128 GAGGTGACCATCACATACTGGGG + Intergenic
1072189197 10:93066663-93066685 GTGGAGCACAGGACATACTGAGG - Intronic
1072461234 10:95620760-95620782 GTGGGGAACATCACACACTGGGG + Intronic
1073694776 10:105852461-105852483 GTGGGGAACATCACACACTGGGG + Intergenic
1074001049 10:109373218-109373240 GTGGGGAACATCACACACTGGGG + Intergenic
1074017821 10:109552259-109552281 GTGGGGAACATCACACACTGGGG + Intergenic
1074025569 10:109630277-109630299 GTGGGGAACATCACACACTGGGG - Intergenic
1074731007 10:116375466-116375488 GAGGGGAACATCACATACTGGGG - Intronic
1075544133 10:123341506-123341528 GTGGGGAACATCACACACTGGGG - Intergenic
1075916562 10:126173076-126173098 GAGGTGAACATCACACACTGGGG + Intronic
1075979632 10:126725418-126725440 GTGGGGAACATCACACACTGGGG - Intergenic
1076661151 10:132056894-132056916 GTGGTCCAGATCCCATCCAGGGG + Intergenic
1077682166 11:4252015-4252037 GTGGGGAACATCACACACTGGGG - Intergenic
1077687873 11:4314727-4314749 GTGGGGAACATCACACACTGGGG + Intergenic
1077700862 11:4441140-4441162 GTGGGGAACATCACACACTGGGG + Intergenic
1077737579 11:4807587-4807609 GTGGGGAACATCACACACTGGGG + Intronic
1077989402 11:7390155-7390177 GTGGGGAACATCACACACTGGGG - Intronic
1078122213 11:8522444-8522466 GTGGGGAACATCACACACTGGGG + Intronic
1078372065 11:10756426-10756448 GAGGGGAACATCACATACTGGGG - Intronic
1078794213 11:14575430-14575452 GTGGGGAACATCACACACTGTGG - Intronic
1078815463 11:14817256-14817278 GTGGGGAACATCACACACTGGGG + Intronic
1079322209 11:19460619-19460641 GTGGGGAACATCACACACTGGGG + Intronic
1079543840 11:21608886-21608908 GTGGGGAACATCACACACTGGGG + Intergenic
1079663154 11:23067521-23067543 AAGGTGAACATCACATACTGGGG - Intergenic
1079929804 11:26543629-26543651 GTGGTGAACATCACACACTGGGG - Intronic
1080366468 11:31579755-31579777 GTGGGGAACATCACACACTGGGG + Intronic
1081186086 11:40043993-40044015 GTGGGGAACATCACACACTGGGG + Intergenic
1082135979 11:48549665-48549687 GTGGAGAACATCACACACTGGGG - Intergenic
1082754460 11:57060071-57060093 GTGGGGCACATCACACACTGGGG - Intergenic
1082905417 11:58302832-58302854 GAGGTGAACATCACAAACTGGGG - Intergenic
1083002894 11:59312661-59312683 GTGGGGAACATCACACACTGGGG + Intergenic
1083005633 11:59343195-59343217 GTGGGGAACATCACACACTGGGG - Intergenic
1083072963 11:60005819-60005841 GAGGGGAACATCACATACTGGGG - Intergenic
1084995912 11:72978131-72978153 GTGGGGAACATCACACACTGGGG + Intronic
1085960564 11:81456725-81456747 GTGGGGAACATCACATACTGGGG + Intergenic
1085996199 11:81917112-81917134 GTGGGGAACATCACACACTGGGG + Intergenic
1086288277 11:85274075-85274097 GTGGGGAACATCACACACTGCGG + Intronic
1086294485 11:85349582-85349604 GTGGGGAACATCACACACTGGGG - Intronic
1086457975 11:86978021-86978043 GTGGGGAACATCACACACTGAGG + Intergenic
1086718205 11:90088941-90088963 ATAATGCACATCCCATACTGGGG + Intergenic
1086803080 11:91201824-91201846 GTGGGGAACATCACACACTGGGG - Intergenic
1087020967 11:93602931-93602953 GTGGGGAACATCACAAACTGGGG + Intergenic
1087898813 11:103617280-103617302 GTGGGGAACATCACACACTGGGG + Intergenic
1088307822 11:108428631-108428653 GAGGGGAACATCACATACTGGGG + Intronic
1088342069 11:108779506-108779528 GTGGGGAACATCACACACTGGGG + Intronic
1088404823 11:109462517-109462539 GAGGGGAACATCACATACTGGGG + Intergenic
1088405437 11:109470948-109470970 GAGGGGAACATCACATACTGGGG + Intergenic
1088594943 11:111434371-111434393 GAGGGGAACATCCCACACTGGGG + Intronic
1089128017 11:116191065-116191087 GTGATGCCCATCCCCTCCTGGGG + Intergenic
1090601504 11:128377199-128377221 GTGGGGAACATCACACACTGGGG - Intergenic
1090606399 11:128426420-128426442 GTGGGGAACATCACACACTGGGG - Intergenic
1090721015 11:129473307-129473329 GTGGGGAACATCACACACTGGGG + Intergenic
1090793062 11:130109019-130109041 GTGGGGAACATCACACACTGGGG + Intronic
1091956735 12:4650296-4650318 GTGGTGCACATCACTTATAGTGG + Intronic
1091959304 12:4678104-4678126 GAGGTGAACATCACACACTGGGG + Intronic
1092326187 12:7533995-7534017 GTGGGGAACATCACACACTGGGG + Intergenic
1092348780 12:7738981-7739003 GTGGGGAACATCACACACTGGGG - Intronic
1092550507 12:9494178-9494200 GTGGGGAACATCCCACACTGGGG - Intergenic
1092799018 12:12144883-12144905 GTGGGGAACATCACACACTGGGG + Intronic
1093326801 12:17785121-17785143 GTGGGGAACATCACACACTGGGG + Intergenic
1093402801 12:18766810-18766832 GAGGTGAACATCACACACTGCGG + Intergenic
1093516596 12:19994218-19994240 GTGGGGAACATCACACACTGGGG + Intergenic
1093987999 12:25559216-25559238 GTGGGGAACATCACACACTGGGG - Intronic
1094023940 12:25942639-25942661 GTGGTACACATCCCTAGCTGTGG + Intergenic
1094036405 12:26076436-26076458 GTGGGGAACATCACACACTGGGG - Intronic
1094248383 12:28329786-28329808 GCGGGGAACATCACATACTGGGG - Intronic
1094521309 12:31192190-31192212 GTGGGGAACATCCCACACTGGGG + Intergenic
1094632144 12:32186232-32186254 GTGGTGTACATTCAATAGTGAGG + Intronic
1094730591 12:33170041-33170063 GAGGGGAACATCACATACTGGGG + Intergenic
1094791011 12:33915162-33915184 GAGGGGAACATCACATACTGGGG - Intergenic
1095140963 12:38661428-38661450 GTGGGGAACATCACACACTGGGG + Intronic
1095544389 12:43347627-43347649 GTGGGGCAAATCCCAGACTTGGG - Intergenic
1095614289 12:44170264-44170286 GTGGGGAACATCACACACTGGGG + Intronic
1095720756 12:45397803-45397825 GTGGGGAACATCACATAGTGGGG + Intronic
1096889964 12:54759972-54759994 GTGTTGCCCATCCCTGACTGAGG + Intergenic
1097301482 12:58023693-58023715 GTGGGGAACATCACACACTGGGG + Intergenic
1097418133 12:59339494-59339516 GTGGGGAACATCACACACTGGGG - Intergenic
1097707090 12:62879582-62879604 GAGGGGAACATCCCACACTGGGG + Intronic
1098637966 12:72807750-72807772 GTGGGGAACATCACACACTGGGG - Intergenic
1098907501 12:76177298-76177320 GTGGTGCAAATCCCACACCAGGG + Intergenic
1098993356 12:77090598-77090620 GTGGGGAACATCACACACTGGGG - Intergenic
1099031376 12:77529708-77529730 GAGGGGCACATCACACACTGGGG + Intergenic
1099135283 12:78890359-78890381 GTGGGGAACATCACACACTGGGG + Intronic
1099602116 12:84753791-84753813 GTGGGGAACATCACACACTGGGG + Intergenic
1099625607 12:85069111-85069133 GTGGGGAACATCACATACCGGGG - Intronic
1099718052 12:86322193-86322215 GTGGGGAACATCACACACTGGGG + Intronic
1099892150 12:88602974-88602996 GTGGGGAACATCACATACCGGGG - Intergenic
1099966077 12:89446572-89446594 GTGGGGAACATCACACACTGGGG + Intronic
1100158664 12:91832059-91832081 GTGGGGAACATCACACACTGGGG + Intergenic
1100166878 12:91926012-91926034 GTGGGGAACATCACACACTGGGG + Intergenic
1100759223 12:97788276-97788298 GAGGGGAACATCACATACTGGGG - Intergenic
1100905463 12:99293321-99293343 GTGGGGAACATCACACACTGGGG + Intronic
1101780433 12:107829916-107829938 GTGGGGAACATCACACACTGGGG - Intergenic
1104327809 12:127816798-127816820 GAGGAGAACATCACATACTGGGG + Intergenic
1104422176 12:128645266-128645288 GTGGTGCCCATCCCTGGCTGTGG - Intronic
1104517119 12:129437910-129437932 GAGGGGAACATCACATACTGGGG - Intronic
1104520718 12:129472402-129472424 GAGGGGAACATCACATACTGGGG + Intronic
1104741625 12:131179776-131179798 GAGGGGAACATCACATACTGGGG + Intergenic
1105244628 13:18637898-18637920 GTGGGGAACATCACACACTGGGG + Intergenic
1105283996 13:18989668-18989690 GTGGGGAACATCACACACTGGGG + Intergenic
1105408913 13:20153603-20153625 GTGGGGAACATCACACACTGGGG + Intronic
1105689364 13:22820670-22820692 GAGGGGAACATCACATACTGGGG + Intergenic
1105699268 13:22923837-22923859 GAGGGGAACATCACATACTGGGG + Intergenic
1106244555 13:27937553-27937575 GTGGGGAACATCACATACTGGGG + Intergenic
1106645796 13:31632600-31632622 GTGGGGAACATCACATACTGGGG - Intergenic
1106654074 13:31723539-31723561 GTGGGGAACATCACACACTGGGG - Intergenic
1106824446 13:33504575-33504597 GTGGGGAACATCACACACTGGGG + Intergenic
1107197688 13:37673116-37673138 GTGGGGAACATCACACACTGGGG - Intronic
1108233943 13:48381866-48381888 GTGGGGAACATCACACACTGGGG - Intronic
1108547436 13:51509887-51509909 GTGGGGAACATCACACACTGGGG - Intergenic
1108551091 13:51545493-51545515 GTGGGGAACATCACACACTGGGG - Intergenic
1108891953 13:55272701-55272723 GTGGGGAACATCCCACAATGGGG - Intergenic
1109050885 13:57479753-57479775 GAGGTGAACATCACACACTGGGG + Intergenic
1109359093 13:61272390-61272412 GTGGGGAACATCACACACTGGGG + Intergenic
1109619035 13:64876984-64877006 GAGGGGAACATCGCATACTGGGG - Intergenic
1109796248 13:67317100-67317122 GTGGGGAACATCACACACTGGGG - Intergenic
1110391824 13:74983216-74983238 GTGGGGAACATCACACACTGGGG - Intergenic
1110699666 13:78532005-78532027 GTGGGGAACATCACACACTGGGG + Intergenic
1111091278 13:83451493-83451515 GTGGGGAACATCACACACTGGGG - Intergenic
1111342098 13:86899840-86899862 GTGGGGAACATCACACACTGGGG + Intergenic
1111352325 13:87047261-87047283 GAGGGGAACATCCCACACTGGGG + Intergenic
1111722587 13:91965053-91965075 GTGGGGAACATCACACACTGGGG + Intronic
1111792710 13:92878975-92878997 GTGGGGAACATCACACACTGGGG - Intergenic
1111840238 13:93440865-93440887 GTGGGGAACATCACACACTGGGG - Intronic
1112042902 13:95565796-95565818 GTGGGGAACATCACACACTGGGG - Intronic
1112232765 13:97606218-97606240 GTGGGGAACATCACATACTGGGG + Intergenic
1112363368 13:98737313-98737335 GTGGGGAACATCACACACTGGGG + Intronic
1112816604 13:103280283-103280305 GTGGGGAACATCACACACTGGGG + Intergenic
1112828351 13:103418437-103418459 GTGGGGAACATCACACACTGGGG + Intergenic
1112946628 13:104935492-104935514 GTGGGGAACATCACACACTGGGG + Intergenic
1113288457 13:108879532-108879554 GTGGGGAACATCACACACTGGGG - Intronic
1114604556 14:23986328-23986350 GTGGGGAACATCACACACTGGGG + Intronic
1114972876 14:28056162-28056184 GTGGGGAACATCACACACTGGGG - Intergenic
1115165703 14:30446667-30446689 GTGGGGAACATCCCACACCGGGG - Intergenic
1115355303 14:32440300-32440322 GTGGGGAACATCACACACTGGGG + Intronic
1115446675 14:33498659-33498681 GAGGGGAACATCACATACTGTGG + Intronic
1115499464 14:34036368-34036390 ATGGTACACATCTCATAGTGTGG - Intronic
1115794944 14:36924496-36924518 GTGGGGAACATCACACACTGGGG + Intronic
1115799945 14:36981658-36981680 GTGGGGAACATCACACACTGGGG + Intronic
1115955069 14:38768655-38768677 GTGGGGAACATCACACACTGGGG + Intergenic
1116027136 14:39528324-39528346 GTGGGGAACATCACACACTGGGG + Intergenic
1116379419 14:44246647-44246669 GAGGGGAACATCACATACTGGGG + Intergenic
1116514405 14:45787881-45787903 GTGGGGAACATCACACACTGGGG - Intergenic
1116689066 14:48081438-48081460 GTGGGGAACATCACATACTGGGG + Intergenic
1116914383 14:50508536-50508558 GTGGAGAACATCACACACTGGGG + Intronic
1117123140 14:52591002-52591024 GTGGGGAACATCACACACTGGGG - Intronic
1117245254 14:53878459-53878481 GTGGGGAACATCACACACTGGGG + Intergenic
1117446555 14:55808721-55808743 GTGGGGAACATCACACACTGGGG - Intergenic
1117636189 14:57746053-57746075 GTGGGGAACATCACACACTGGGG + Intronic
1117893170 14:60449006-60449028 GTGGGGAACATTACATACTGGGG + Intronic
1118583423 14:67327660-67327682 GTGGGGAACATCACACACTGGGG - Intronic
1119146161 14:72316407-72316429 GTGGGGAACATCACACACTGGGG - Intronic
1120114270 14:80595291-80595313 GAGGGGAACATCACATACTGGGG + Intronic
1120218548 14:81706599-81706621 GTGGGGAACATCACACACTGGGG - Intergenic
1120535475 14:85689833-85689855 GAGGGGAACATCACATACTGGGG + Intergenic
1120654118 14:87169119-87169141 TTGGTGCACCTACCATTCTGGGG + Intergenic
1120935902 14:89894445-89894467 GAGGGGAACATCACATACTGGGG - Intronic
1120977508 14:90262119-90262141 GTGGGGAACATCACACACTGGGG + Intronic
1121597411 14:95175672-95175694 GTGGGGAACATCACACACTGGGG - Intergenic
1121759035 14:96428134-96428156 GTGGGGAACATCACACACTGAGG - Intronic
1122833004 14:104412214-104412236 GTGGGGAACATCACACACTGGGG - Intergenic
1124798354 15:32804681-32804703 GTGGGGAACATCACACACTGGGG - Intronic
1125070073 15:35544323-35544345 GAGGGGCACATCACACACTGGGG + Intronic
1125119527 15:36137887-36137909 GTGGGGAACAACACATACTGGGG - Intergenic
1125289106 15:38125980-38126002 GAGGGGAACATCCCACACTGGGG + Intergenic
1125331462 15:38586682-38586704 GTGGGGAACATCACACACTGGGG + Intergenic
1125753195 15:42044604-42044626 GTGGGGAACATCACACACTGGGG + Intronic
1126214747 15:46142326-46142348 GAGGGGAACATCCCACACTGAGG - Intergenic
1126541227 15:49826315-49826337 GTGGGGAACATCACACACTGGGG - Intergenic
1126727685 15:51648995-51649017 GTGGGGAACATCACACACTGGGG + Intergenic
1126854993 15:52829951-52829973 GTGGAGAACATCACACACTGGGG + Intergenic
1127125581 15:55808597-55808619 GTGGGGAACATCACATACTGGGG + Intergenic
1127151847 15:56083821-56083843 GTGGGGAACATCACACACTGGGG + Intergenic
1127565972 15:60188611-60188633 GTGGGGAACATCACACACTGGGG + Intergenic
1127686189 15:61347377-61347399 GTGGGGAACATCACACACTGGGG + Intergenic
1127844912 15:62861494-62861516 GTGGGGAACATCACACACTGGGG + Intergenic
1128720609 15:69945419-69945441 GTGGGGAACATCACACACTGGGG + Intergenic
1129579027 15:76785846-76785868 GTGGGGAACATCACACACTGGGG + Intronic
1129795981 15:78376133-78376155 GTGGGGAACATCACACACTGGGG - Intergenic
1130302487 15:82690424-82690446 GTGGGGAACATCACACACTGGGG - Intronic
1130471022 15:84226598-84226620 GTGGGGAACATCACACACTGGGG - Intergenic
1130478516 15:84341168-84341190 GTGGGGAACATCACACACTGGGG - Intergenic
1130493254 15:84446963-84446985 GTGGGGAACATCACACACTGGGG + Intergenic
1130751577 15:86718358-86718380 GTGGGGAACATCACACACTGGGG + Intronic
1131202418 15:90410656-90410678 GTGGGGAACATCACACACTGGGG + Intronic
1131475956 15:92739586-92739608 GTGGGGAACATCACACACTGGGG + Intronic
1131478312 15:92760582-92760604 GTGGGGAACATCACACACTGGGG + Intronic
1131498080 15:92932464-92932486 GTGGGGAACATCACACACTGTGG - Intronic
1131589011 15:93728321-93728343 GTGGGGGACATCACACACTGGGG - Intergenic
1131591382 15:93752626-93752648 GTGGGGAACAACACATACTGGGG + Intergenic
1131715237 15:95102630-95102652 GAGGGGAACATCACATACTGGGG + Intergenic
1134309059 16:13059485-13059507 GTGGGGGACATCACATACTGGGG + Intronic
1134344215 16:13374336-13374358 GTGGGGAACATCACACACTGGGG - Intergenic
1134556185 16:15167413-15167435 GAGGGGAACATCACATACTGGGG + Intergenic
1134916768 16:18079148-18079170 GAGGGGAACATCACATACTGGGG + Intergenic
1135166580 16:20144416-20144438 GTGGGGAACATCACACACTGGGG - Intergenic
1135427462 16:22351033-22351055 GTGGGGAACATCACACACTGGGG - Intronic
1135796662 16:25450571-25450593 GAGGGGAACATCACATACTGGGG - Intergenic
1135897855 16:26425204-26425226 GTGGGGAACATCACACACTGGGG + Intergenic
1137233449 16:46591137-46591159 GTGGGGAACATCACACACTGGGG + Intronic
1137403137 16:48169736-48169758 GTGGGGAACATCACACACTGGGG + Intronic
1137471622 16:48764679-48764701 GTGGGGAACATCACACACTGGGG + Intergenic
1137525654 16:49234046-49234068 GTGGGGAACATCACACACTGGGG + Intergenic
1138064845 16:53929921-53929943 GTGGTCCACATCTCACATTGTGG - Intronic
1138734425 16:59234037-59234059 GTGGGGAACATCACACACTGGGG + Intergenic
1140653709 16:77117594-77117616 GAGGGGAACATCACATACTGGGG - Intergenic
1202995456 16_KI270728v1_random:105312-105334 GTGGGGAACATCACACACTGGGG + Intergenic
1203022143 16_KI270728v1_random:417654-417676 GTGGGGAACATCACACACTGGGG + Intergenic
1143365362 17:6404891-6404913 GTGGGGAACATCACACACTGGGG - Intronic
1143793627 17:9318292-9318314 GTGGGGAACATCACACACTGGGG - Intronic
1145070092 17:19797536-19797558 CGTGTGCCCATCCCATACTGGGG - Exonic
1145757622 17:27404174-27404196 GAGGGGAACATCACATACTGGGG + Intergenic
1147193169 17:38748677-38748699 GTGATGCCCATCCCTAACTGGGG + Intronic
1147271564 17:39276168-39276190 GTGGTGCAAATCTCCTCCTGGGG - Intronic
1149006500 17:51811456-51811478 GTGGGGAACATCACACACTGGGG - Intronic
1149090660 17:52774319-52774341 GTGGGGAACATCACACACTGGGG - Intergenic
1149246231 17:54711732-54711754 GAGGGGAACATCACATACTGGGG + Intergenic
1150026280 17:61677783-61677805 GTGGGGAACATCACACACTGGGG + Intergenic
1150098507 17:62400399-62400421 GTGGGGAACATCACACACTGGGG - Intronic
1150193700 17:63271630-63271652 GAGGGGAACATCACATACTGGGG - Intronic
1150426862 17:65084087-65084109 GTGGGGAACATCACACACTGGGG + Intergenic
1150932863 17:69604040-69604062 GTGGGGAACATCACACACTGGGG + Intergenic
1151035937 17:70800016-70800038 GTGGGGAACATCACATACTGGGG + Intergenic
1152328338 17:79655786-79655808 TTGGTGGACACCCCATACTGAGG - Intergenic
1154444310 18:14422002-14422024 GTGGGGAACATCACACACTGGGG - Intergenic
1155012668 18:21796363-21796385 GAGGGGAACATCACATACTGGGG + Intronic
1155175399 18:23297391-23297413 GTGGTGCACATCAGCTACTGTGG + Exonic
1155351093 18:24907041-24907063 GTGGGGAACATCACACACTGGGG + Intergenic
1155414114 18:25578764-25578786 GTGGGGAACATCGCACACTGGGG + Intergenic
1155476335 18:26238760-26238782 GTGGGGAACATCACACACTGGGG - Intronic
1155478420 18:26259454-26259476 GTGGGGAACATCACACACTGGGG - Intronic
1155640539 18:28008565-28008587 GTGGAGAACATCACACACTGGGG + Intronic
1155763197 18:29591710-29591732 GAGGTGAACATCACACACTGGGG + Intergenic
1155812528 18:30255640-30255662 GAGAGGAACATCCCATACTGGGG + Intergenic
1155927345 18:31670922-31670944 GTGGGGAACATCACACACTGGGG - Intronic
1156298541 18:35815358-35815380 GTGGGGAACATCACACACTGGGG + Intergenic
1156434982 18:37117463-37117485 GTAGCGAACATCCCACACTGGGG + Intronic
1157318438 18:46614539-46614561 GTGGGGAACATCACATACTGGGG + Intronic
1157659409 18:49426366-49426388 GTGGGGAACATCACACACTGGGG + Intronic
1158792360 18:60797338-60797360 GTGGGGAACATCACACACTGAGG - Intergenic
1159191801 18:65054980-65055002 GTGGGGAACATCACACACTGGGG - Intergenic
1159613396 18:70551130-70551152 GTGGGGAACATCACACACTGGGG + Intergenic
1160114223 18:76062432-76062454 GAGGGGAACATCACATACTGGGG - Intergenic
1160381739 18:78462515-78462537 GAGGGGAACATCACATACTGGGG - Intergenic
1162287172 19:9747453-9747475 GTGGGGAACATCACACACTGGGG - Intergenic
1164035055 19:21446311-21446333 GAGGTGAACATCACACACTGGGG - Intronic
1164110622 19:22154329-22154351 GTGGAGAACATCACACACTGGGG + Intergenic
1164166374 19:22679484-22679506 GTGGGGAACATCACACACTGGGG + Intergenic
1164195630 19:22955485-22955507 GTGGGGAACATCACACACTGGGG + Intergenic
1164499804 19:28808603-28808625 GTGGGGAACATCACACACTGGGG + Intergenic
1164655190 19:29915892-29915914 GTGGGGAACATCACACACTGGGG - Intergenic
1165097196 19:33416116-33416138 GGGGTGGACATTCCAAACTGGGG + Intronic
1165859172 19:38898315-38898337 TTGTTCCACATCCCACACTGGGG - Intronic
1167723740 19:51197129-51197151 GTGGGGAACATCACACACTGGGG - Intergenic
1168389602 19:55995179-55995201 GTGGGGAACATCACACACTGGGG + Intergenic
924968276 2:99201-99223 GAGGGGAACATCACATACTGGGG + Intergenic
925427279 2:3760648-3760670 GAGGGGCACATCACACACTGGGG + Intronic
925518234 2:4708915-4708937 GTGGGGAACATCACACACTGGGG + Intergenic
925630721 2:5890295-5890317 GTGGGGAACATCACACACTGGGG - Intergenic
925653754 2:6122466-6122488 GTGGGGAACATCACACACTGGGG + Intergenic
925742536 2:7018514-7018536 GGGGTGCACATGCCAGCCTGGGG - Intronic
926452405 2:13021512-13021534 ATGGTGCACATCCCACAGTGGGG - Intergenic
926539736 2:14160511-14160533 GTGGGGAACATCACACACTGGGG + Intergenic
926721315 2:15963443-15963465 GTGGGGAACATCACACACTGGGG + Intergenic
926848223 2:17165641-17165663 GAGGGGAACATCACATACTGGGG - Intergenic
926851665 2:17204757-17204779 GTGGGGAACATCACACACTGGGG - Intergenic
926927597 2:18003339-18003361 GAGGTGAACATCACACACTGGGG + Intronic
927183355 2:20464592-20464614 GTGGGGAACATCACACACTGGGG + Intergenic
927297734 2:21474544-21474566 GAGGGGAACATCACATACTGGGG - Intergenic
927308061 2:21596515-21596537 CTGGGGAACATCACATACTGGGG - Intergenic
928462977 2:31492671-31492693 ATGGGGGACATCACATACTGGGG + Intergenic
928480507 2:31678264-31678286 GTGGGGAACATCACACACTGGGG - Intergenic
928493474 2:31807468-31807490 GTGGGGAACATCACACACTGGGG + Intergenic
928864441 2:35901090-35901112 GTGGGGAACATCACACACTGGGG - Intergenic
929331032 2:40681295-40681317 GTGGGGAACATCACACACTGGGG - Intergenic
929577436 2:43060817-43060839 TCGGTGCACATCCCAGACTGAGG - Intergenic
929957805 2:46472221-46472243 GTGGGGAACATCACACACTGGGG - Intronic
930267384 2:49215754-49215776 GTGGGGAACATCACACACTGGGG + Intergenic
930275348 2:49304359-49304381 GTGGGGAACATCACACACTGGGG + Intergenic
930502212 2:52235671-52235693 GTGGGGAACATCACACACTGGGG + Intergenic
930961776 2:57271031-57271053 GTGGGGAACATCACACACTGGGG - Intergenic
931841386 2:66153418-66153440 GTGGGGAACATCACATACTGGGG + Intergenic
933268737 2:80210384-80210406 GTGGGGAACATCACATACTGGGG - Intronic
933323951 2:80812428-80812450 GTGGAGAACATCACACACTGGGG + Intergenic
933567205 2:83964939-83964961 GTGGGGAACATCACACACTGGGG + Intergenic
933685434 2:85137403-85137425 TTGGCCCACATCCCATGCTGAGG - Intronic
934163946 2:89277487-89277509 GTGGGGAACATCACACACTGGGG + Intergenic
934203326 2:89905037-89905059 GTGGGGAACATCACACACTGGGG - Intergenic
934314782 2:91907299-91907321 GTGGGGAACATCACACACTGGGG + Intergenic
934532143 2:95098657-95098679 GTGGGGAACATCACACACTGGGG + Intronic
935393533 2:102580561-102580583 GTGGGGAACATCACACACTGGGG - Intergenic
936351175 2:111713718-111713740 GTGGGGAACATCACACACTGGGG + Intergenic
936407825 2:112223079-112223101 GTGGGGAACATCACACACTGGGG + Intronic
936649340 2:114408297-114408319 GTGGGGAACATCACACACTGGGG - Intergenic
936720006 2:115239773-115239795 GAGGGGAACATCACATACTGGGG - Intronic
936749854 2:115628986-115629008 GTGGGGAACATCACACACTGGGG - Intronic
936777830 2:115995133-115995155 GTGGGGAACATCACACACTGGGG - Intergenic
936823964 2:116557737-116557759 GTGGGGAACATCACACACTGGGG + Intergenic
936908801 2:117568954-117568976 GTGGGGAACATCACACACTGGGG + Intergenic
937423826 2:121780615-121780637 GTGGGGAACATCACACACTGGGG + Intergenic
937485759 2:122313270-122313292 GTGGGGAACATCACACACTGGGG + Intergenic
937740760 2:125350263-125350285 GAGGAGAACATCACATACTGGGG - Intergenic
937902200 2:127028788-127028810 GAGGGGAACATCACATACTGGGG - Intergenic
938208833 2:129447353-129447375 GTGGGGAACATCACACACTGGGG + Intergenic
938423800 2:131167273-131167295 GGGGGGAACATCCCATACCGGGG - Intronic
938590589 2:132732262-132732284 GTGGGGAACATCACACACTGGGG + Intronic
939000746 2:136731158-136731180 GTGGGGAACATCACACACTGGGG - Intergenic
939773898 2:146360476-146360498 TAGGTTCACATACCATACTGTGG - Intergenic
939817125 2:146910092-146910114 GAGGGGAACATCACATACTGGGG - Intergenic
939964465 2:148596903-148596925 GAGGGGAACATCACATACTGGGG + Intergenic
940193443 2:151066712-151066734 GTGGGGAACATCACACACTGGGG - Intergenic
940248106 2:151641984-151642006 GTGGGGAACATCACACACTGGGG - Intronic
940703316 2:157073572-157073594 GTGGGGAACATCACACACTGGGG + Intergenic
940720220 2:157273995-157274017 GTGGGGAACATCACACACTGGGG - Intronic
940989971 2:160086958-160086980 GTGGGGAACATCACACACTGGGG + Intergenic
941226491 2:162856355-162856377 GTGGGGAACATCACACACTGGGG + Intergenic
941300158 2:163790758-163790780 GTGGGGAACATCACACACTGGGG + Intergenic
941654112 2:168124943-168124965 GAGGGGAACATCACATACTGGGG + Intronic
942111889 2:172690821-172690843 GTGGGGAACATCACACACTGGGG + Intergenic
942431823 2:175920266-175920288 GTGGGGAACATCACACACTGAGG + Intergenic
942958187 2:181798724-181798746 GTGGGGAACATCACACACTGGGG - Intergenic
943037919 2:182768996-182769018 GGGGGGAACATCACATACTGGGG - Intronic
943074175 2:183174518-183174540 GAGGGGAACATCACATACTGGGG - Intergenic
943255848 2:185591961-185591983 GTGGGGAACATCACACACTGGGG - Intergenic
943353884 2:186826621-186826643 GTGGGGAACAACCCACACTGGGG + Intergenic
943642109 2:190371155-190371177 GTGCTGCTCATGCCATACTGAGG + Exonic
943945217 2:194052283-194052305 GTGGGGAACATCACACACTGGGG + Intergenic
944135423 2:196394117-196394139 GTGGGGAACATCCCACACTGGGG + Intronic
944256649 2:197629415-197629437 GTGGGAAACATCACATACTGGGG + Intronic
944701917 2:202253462-202253484 GTGGGGAACATCACACACTGGGG + Intergenic
945006786 2:205417100-205417122 GTGGGGAACATCACACACTGGGG - Intronic
945107549 2:206330210-206330232 GAGGGGAACATCACATACTGGGG - Intergenic
945694650 2:213087672-213087694 GTGGGGAACATCACACACTGGGG - Intronic
945776268 2:214110308-214110330 GTGGGGAACATCACACACTGGGG - Intronic
945786933 2:214252466-214252488 GAGGGGAACATCACATACTGTGG - Intronic
946068557 2:217011255-217011277 GTGGGGAACATCACACACTGGGG - Intergenic
946205356 2:218102776-218102798 GTGGGGAACATCACACACTGGGG - Intergenic
946635332 2:221718824-221718846 GTGGGGAACATCACACACTGGGG - Intergenic
946794589 2:223336475-223336497 GTGGGGAACATCACACACTGGGG + Intergenic
947068322 2:226256023-226256045 GTGGGGCACGTCACACACTGCGG + Intergenic
947776912 2:232720115-232720137 GTGGGGAACATCACACACTGGGG - Intronic
1169177202 20:3527888-3527910 GAGGGGAACATCGCATACTGGGG + Intronic
1169423337 20:5476960-5476982 GTGGGGAACATCACACACTGGGG + Intergenic
1169428921 20:5518844-5518866 GTGGGGAACATCACACACTGGGG + Intergenic
1169634851 20:7678131-7678153 GTGGGGAACATCACACACTGGGG + Intergenic
1169658388 20:7951706-7951728 GTGGGGAACATCACACACTGGGG - Intergenic
1169711459 20:8569110-8569132 CTGCTGCTCATCCCATACTTGGG + Intronic
1170014180 20:11762694-11762716 GTGGGGAACATCACACACTGGGG - Intergenic
1171007416 20:21480160-21480182 GTGGCGAACATCACACACTGGGG - Intergenic
1171039375 20:21745848-21745870 GTGGGGAACATCACACACTGGGG - Intergenic
1171418659 20:25001364-25001386 GTGGGGAACATCACACACTGGGG - Intergenic
1171939463 20:31311740-31311762 GTGGGGAACATCACACACTGGGG - Intergenic
1172363129 20:34328554-34328576 GTGGGGAACATCACACACTGGGG + Intergenic
1172396747 20:34612324-34612346 GAGGTGAACATCACACACTGGGG + Intronic
1173296773 20:41766643-41766665 GTGGGGAACATCACACACTGGGG + Intergenic
1174905534 20:54546569-54546591 GTGGGGAACATCACACACTGGGG - Intronic
1175018121 20:55813666-55813688 GTGGGGGACATCACACACTGGGG - Intergenic
1175060914 20:56241825-56241847 GTGGGGAACATCACACACTGGGG + Intergenic
1175307386 20:57985832-57985854 GTGGGGAACATCACACACTGGGG - Intergenic
1175326542 20:58133034-58133056 GGAGGGCACATCCCAAACTGGGG + Intergenic
1175558205 20:59890368-59890390 GAGGTGAACATCACACACTGGGG + Intronic
1176518412 21:7805047-7805069 GTGGGGAACATCACACACTGGGG - Intergenic
1177240076 21:18444453-18444475 GAGGGGAACATCCCACACTGGGG + Intronic
1177296504 21:19183021-19183043 AGGGTGGACATCCCACACTGGGG + Intergenic
1177351193 21:19944047-19944069 GTGGTGAACAACACATACTGGGG - Intergenic
1177848234 21:26316886-26316908 GTGGGGAACATCACACACTGGGG - Intergenic
1178463405 21:32824069-32824091 GTGGGGAACATCACACACTGGGG + Intergenic
1178652440 21:34435060-34435082 GTGGGGAACATCACACACTGGGG - Intergenic
1180541541 22:16453174-16453196 GTGGGGAACATCACATGCTGGGG + Intergenic
1182888402 22:33795819-33795841 GTGGGGAACATCACACACTGGGG + Intronic
1183039358 22:35164975-35164997 GAGGGGAACATCACATACTGGGG - Intergenic
949240506 3:1865653-1865675 GAGGGGAACATCACATACTGGGG + Intergenic
949273776 3:2254060-2254082 GAGGGGAACATCACATACTGGGG - Intronic
949960209 3:9305580-9305602 GTGGGGAACATCACACACTGGGG - Intronic
950130422 3:10540689-10540711 GTGGAGAACATCACACACTGGGG + Intronic
951382209 3:21997319-21997341 GTGGGGAACATCACACACTGGGG + Intronic
951525963 3:23653132-23653154 GTGGGGAACATCACACACTGGGG + Intergenic
951604168 3:24413737-24413759 GTGGGGAACATCACACACTGGGG - Intronic
951776428 3:26315331-26315353 GTGGGGAACATCACACACTGGGG - Intergenic
952436975 3:33281215-33281237 GTGGGGAACATCACACACTGGGG - Intronic
952602446 3:35101486-35101508 GTGGGGAACATCACACACTGGGG - Intergenic
952813460 3:37425526-37425548 GTGGGGAACATCACACACTGGGG - Intronic
953595470 3:44308298-44308320 GTGGGGAACATCACACACTGGGG - Intronic
954536559 3:51363657-51363679 GTGGGGAACATCACACACTGGGG - Intronic
955982943 3:64545578-64545600 GTGGGGAACATCACATACCGGGG + Intronic
956357734 3:68412547-68412569 GTGGGGAACATCACACACTGGGG - Intronic
956409705 3:68966938-68966960 GTGGGGAACATCACACACTGGGG + Intergenic
956541050 3:70340212-70340234 GTGGGGAACATCACACACTGAGG + Intergenic
956556190 3:70525870-70525892 ATGGTGTAAATCCCATTCTGAGG + Intergenic
956781824 3:72609495-72609517 GTGGGGAACATCACACACTGGGG + Intergenic
956847159 3:73193966-73193988 GTGGGGAACATCACACACTGGGG - Intergenic
956939071 3:74136188-74136210 GTGGTGCACATACCATAAGAAGG + Intergenic
956951695 3:74291070-74291092 GTGGGGAACATCACACACTGGGG - Intronic
957061349 3:75483629-75483651 GTGGGGAACATCACACACTGGGG - Intergenic
957195058 3:77057281-77057303 GTGGGGAACATCACACACTGGGG + Intronic
957459896 3:80502512-80502534 GAGGGGCACATCACACACTGGGG - Intergenic
957562063 3:81834626-81834648 GTGGGGAACATCACACACTGGGG - Intergenic
957644877 3:82907974-82907996 GTGGGGAACATCCCACTCTGGGG + Intergenic
957899845 3:86475076-86475098 GTGGAGAACATCACACACTGGGG + Intergenic
958003256 3:87778303-87778325 GTGGGGAACATCACATACTGGGG + Intergenic
958443176 3:94180866-94180888 GTGGGGAACATCACACACTGAGG - Intergenic
958954017 3:100447419-100447441 GGGGGGAACATCACATACTGGGG + Intronic
959243582 3:103831927-103831949 GAGGGGAACATCACATACTGGGG + Intergenic
959487269 3:106941326-106941348 GTGGGGAACATCACACACTGGGG + Intergenic
959763475 3:109996634-109996656 GTGGGGAACATCACACACTGGGG - Intergenic
959829699 3:110845666-110845688 GAGGGGAACATCACATACTGGGG + Intergenic
959954273 3:112217175-112217197 GTGGGGAACATCACACACTGGGG + Intronic
960151922 3:114258133-114258155 GTGGGGAACATCACACACTGGGG + Intergenic
961395564 3:126586172-126586194 GTGGGGAACATCACACACTGGGG - Intronic
961910935 3:130315938-130315960 GTGGGGAACATCACACACTGGGG + Intergenic
961963503 3:130878108-130878130 GTGGGGAACATCACACACTGGGG + Intronic
962624985 3:137216980-137217002 GTGGGGAACATCACAGACTGGGG + Intergenic
962656514 3:137549597-137549619 GTGGGGAACATCACACACTGGGG + Intergenic
962907926 3:139822383-139822405 GTGGGGGACATCACACACTGGGG + Intergenic
963340547 3:144027276-144027298 GTGGGGAACATCACACACTGGGG + Intronic
963437124 3:145286066-145286088 GTGGGGAACATCACACACTGGGG - Intergenic
963580800 3:147124368-147124390 GTGGGGAACATCACACACTGGGG - Intergenic
963712449 3:148762199-148762221 GAGGAGAACATCCCACACTGGGG + Intergenic
963811864 3:149785431-149785453 GTGGGGAACATCACACACTGCGG - Intronic
963842613 3:150122940-150122962 GTGGGGAACATCACACACTGGGG - Intergenic
963976848 3:151489791-151489813 GAGGGGAACATCACATACTGGGG + Intergenic
964153450 3:153556987-153557009 GAGGGGAACATCACATACTGAGG - Intergenic
964259563 3:154820165-154820187 GTGGGGCAAATCACACACTGGGG - Intergenic
964516356 3:157512885-157512907 GTGTTGTAGATGCCATACTGTGG - Intronic
964597822 3:158456537-158456559 GTGCTGTACATCCCATAAAGAGG + Intronic
965088866 3:164136870-164136892 GTGGGGAACATCACACACTGGGG + Intergenic
965161078 3:165134584-165134606 GTGGGGAACATCACACACTGGGG - Intergenic
965345812 3:167548863-167548885 GTGGGGAACATCACACACTGGGG - Intronic
965685007 3:171293388-171293410 GTGGTGCACATCCTACCCTTGGG - Intronic
965739519 3:171859120-171859142 GTGGGGAACATCACACACTGGGG + Exonic
965800752 3:172491403-172491425 GTGGGGAACATCACACACTGGGG - Intergenic
965884600 3:173429763-173429785 GTGCTGCCCATCCCAGATTGGGG + Intronic
966030983 3:175347906-175347928 GAGGGGAACATCACATACTGGGG - Intronic
966224497 3:177583457-177583479 GAGGGGAACATCACATACTGGGG + Intergenic
966536517 3:181041066-181041088 GTGGGGAACATCACACACTGGGG - Intergenic
967108783 3:186274558-186274580 GTGGGGAACATCACACACTGGGG - Intronic
967569362 3:191010712-191010734 GTGGCGAACATCACACACTGGGG - Intergenic
967754176 3:193149816-193149838 GTGGGGAACATCACATACTGGGG + Intergenic
970487922 4:16542945-16542967 GTGGGGAACATCACATACTGGGG - Intronic
970945357 4:21684839-21684861 GTGGGGAACATCACACACTGGGG - Intronic
970983535 4:22129115-22129137 GTGGGGAACATCACACACTGGGG + Intergenic
971654968 4:29332434-29332456 GAGGTGAATATCCCACACTGGGG + Intergenic
971768787 4:30869454-30869476 GAGGTGAACATCACACACTGGGG - Intronic
971795155 4:31217515-31217537 GTGGGGAACATCACACACTGGGG - Intergenic
972864216 4:43210439-43210461 GTGGGGAACATCACACACTGGGG + Intergenic
972910994 4:43816866-43816888 GAGGGGAACATCACATACTGGGG - Intergenic
973055912 4:45657138-45657160 GTGGGGAACATCACACACTGGGG + Intergenic
973173847 4:47179136-47179158 GTGGGGAACATCACACACTGGGG - Intronic
973322732 4:48826324-48826346 GTGGGGAACATCACACACTGGGG - Intronic
973870814 4:55164446-55164468 GTGGGGAACATCACACACTGGGG - Intergenic
974045025 4:56891469-56891491 GTGGGGAACATCACACACTGGGG + Intergenic
974077413 4:57179994-57180016 GTGGGGAACATCACACACTGGGG - Intergenic
974143196 4:57914941-57914963 GTGGGGAACATCACACACTGGGG + Intergenic
974177181 4:58339285-58339307 GTGGGGAACATCACACACTGGGG + Intergenic
974254002 4:59425602-59425624 GTGGGGAACATCACACACTGGGG + Intergenic
974284613 4:59847777-59847799 GTGGAGAACATCACACACTGGGG + Intergenic
974288335 4:59897940-59897962 GTGGGGAACATCACACACTGGGG + Intergenic
974455318 4:62123178-62123200 GAGGGGAACATCACATACTGGGG - Intergenic
974585149 4:63864431-63864453 GTGGGGAACATCACACACTGGGG + Intergenic
974974244 4:68870246-68870268 GTGGGGAACATCACACACTGGGG - Intergenic
975069598 4:70117856-70117878 GTGGGGAACATCACACACTGGGG - Intergenic
975075779 4:70207386-70207408 GTGGGGAACATCACACACTGGGG - Intergenic
975087163 4:70355885-70355907 GTGGGGAACATCACACACTGGGG + Intergenic
975116058 4:70682482-70682504 GTGGGGAACATCACACACTGGGG + Intronic
975232688 4:71953514-71953536 GTGGGGAACATCACACACTGGGG + Intergenic
975368632 4:73557514-73557536 GTGGGGAACATCACACACTGGGG + Intergenic
975483640 4:74910368-74910390 GAGGGGAACATCACATACTGGGG - Intergenic
975630810 4:76400374-76400396 GTGGGGAACATCACATACCGGGG + Intronic
975726391 4:77295674-77295696 GTGGGGAACATCACAAACTGGGG - Intronic
975950214 4:79761433-79761455 GCGGGGAACATCACATACTGGGG - Intergenic
976134248 4:81918917-81918939 GTGTTGCACATTCCATGCTATGG + Intronic
976380852 4:84396632-84396654 GTGGGGAACATCACACACTGGGG - Intergenic
977021385 4:91764942-91764964 GTGGGGAACATCACACACTGGGG + Intergenic
977057771 4:92215026-92215048 GTGGGGAACATCACACACTGGGG + Intergenic
977061256 4:92259341-92259363 GTGGGGAACATCACACACTGGGG - Intergenic
977170328 4:93753514-93753536 GTGGGGAACATCACACACTGGGG - Intronic
977185125 4:93927251-93927273 GAGGGGAACATCACATACTGGGG - Intergenic
977367144 4:96084357-96084379 GAGGGGAACATCCCACACTGGGG + Intergenic
977469480 4:97424883-97424905 GTGGGGAACATCACACACTGGGG - Intronic
977533216 4:98224888-98224910 ATGGAGCACAGGCCATACTGAGG + Intergenic
977819347 4:101454031-101454053 GTGGGGAACATCACACACTGGGG - Intronic
977947015 4:102925374-102925396 GTGGGGAACATCACACACTGGGG + Intronic
978325347 4:107547515-107547537 GTGGGGAACATCACACACTGGGG - Intergenic
978364121 4:107962635-107962657 GTGGGGAACATCACACACTGGGG + Intergenic
978537799 4:109780967-109780989 GTGGGGAACATCACACACTGGGG + Intronic
978743367 4:112164084-112164106 GTGGGGAACATCACACACTGGGG + Intronic
978777670 4:112519325-112519347 GAGGGGAACATCACATACTGGGG + Intergenic
979004948 4:115282412-115282434 GTGGGGAACATCACACACTGGGG + Intergenic
979501532 4:121446063-121446085 GAGGGGAACATCACATACTGGGG + Intergenic
979528756 4:121745461-121745483 GTGGGGAACATCACACACTGGGG - Intergenic
979953257 4:126921805-126921827 GAGGGGAACATCACATACTGGGG + Intergenic
980551105 4:134336366-134336388 GCGGGGAACATCACATACTGGGG - Intergenic
980608474 4:135124297-135124319 GTGGTGCAAATGACATACTTGGG - Intergenic
980849285 4:138360703-138360725 GTGGGGAACATCACACACTGGGG + Intergenic
981272680 4:142862790-142862812 GTGGGGAACATCACACACTGGGG + Intergenic
981311295 4:143300422-143300444 GTGGGGAACATCACACACTGGGG + Intergenic
981394912 4:144235954-144235976 GTGGGGAACATCACACACTGGGG - Intergenic
981496871 4:145403600-145403622 GTGGGGAACATCACACACTGGGG + Intergenic
981514390 4:145591492-145591514 GTGGGGAACATCACACACTGGGG - Intergenic
981668727 4:147260479-147260501 GTGGGGAACATCACACACTGGGG + Intergenic
981759905 4:148182992-148183014 GTGGGGAACATCACACACTGGGG - Intronic
981855805 4:149290617-149290639 GAGGAGAACATCCCACACTGGGG + Intergenic
981875952 4:149545989-149546011 GTGGGGAACATCACACACTGGGG - Intergenic
982257136 4:153461909-153461931 GTGGGGAACATCACACACTGGGG + Intergenic
982852425 4:160336656-160336678 GAGGGGAACATCACATACTGGGG - Intergenic
982854901 4:160369487-160369509 GTGGGGAACATCACACACTGGGG + Intergenic
982931419 4:161412470-161412492 GTGGGGAACATCACACACTGGGG + Intronic
983429600 4:167631766-167631788 GAGGGGAACATCACATACTGGGG + Intergenic
983457376 4:167982193-167982215 GTGGGGAACATCACACACTGGGG - Intergenic
983618929 4:169738959-169738981 GTGGGGAACATCACACACTGGGG + Intronic
984228073 4:177059319-177059341 GTGGGGAACATCACACACTGGGG - Intergenic
984354008 4:178635137-178635159 GAGGGGAACATCCCACACTGGGG + Intergenic
984442592 4:179791788-179791810 GTGGTGCATCTACCATTCTGGGG - Intergenic
985242777 4:187948433-187948455 GTGGGGAACATCACACACTGGGG - Intergenic
985918040 5:2942168-2942190 GAGGGGAACATCACATACTGGGG - Intergenic
986355540 5:6921511-6921533 GAGGGGAACATCACATACTGAGG - Intergenic
986766004 5:10927239-10927261 GTGGGGAACATCACACACTGGGG + Intergenic
986898239 5:12397343-12397365 GTGGGGAACATCACACACTGGGG + Intergenic
986912793 5:12577277-12577299 GTGGGGAACATCACACACTGGGG + Intergenic
986953847 5:13125732-13125754 GAGGGGAACATCACATACTGGGG + Intergenic
987395214 5:17416408-17416430 GTGGGGAACATCACATACTGGGG - Intergenic
987529634 5:19101060-19101082 GTGGGGAACATCACACACTGGGG + Intergenic
987533368 5:19150254-19150276 GTGGGGAACATCACATACGGGGG - Intergenic
987784097 5:22476925-22476947 GTGGTGGAGTTACCATACTGAGG + Intronic
987880204 5:23734458-23734480 GTGGGGAACATCACACACTGGGG - Intergenic
987902955 5:24037395-24037417 GTGGGGAACATCACACACTGGGG - Intronic
988010558 5:25476485-25476507 GTGGGGAACATCACACACTGGGG + Intergenic
989044260 5:37258973-37258995 GTGGGGAACATCACACACTGGGG - Intergenic
989244791 5:39242310-39242332 GTGGGGAACATCACACACTGGGG - Intronic
989254182 5:39348991-39349013 GTGGGGAACATCACACACTGGGG + Intronic
989320189 5:40125250-40125272 GAGGAGAACATCACATACTGGGG - Intergenic
989344763 5:40417403-40417425 GCGGTGAACATCACACACTGGGG - Intergenic
989464809 5:41742653-41742675 GTGGGGAACATCACACACTGGGG - Intronic
989487079 5:42003689-42003711 GTGGGGAACATCACACACTGGGG - Intergenic
989502170 5:42180194-42180216 GTGGGGAACATCACACACTGTGG + Intergenic
989614211 5:43323063-43323085 GTGGGGAACATCACATACCGGGG - Intergenic
989823031 5:45818576-45818598 GTGGGGAACATCACAAACTGAGG + Intergenic
989954953 5:50347682-50347704 GTGGGGAACATCACACACTGGGG - Intergenic
990304024 5:54477499-54477521 GTGGGGAACATCACACACTGGGG + Intergenic
990582190 5:57175173-57175195 GGGGTGCAGATCCCATACTGGGG - Intronic
990926364 5:61029656-61029678 CTGGTGCACGTCGCATTCTGGGG - Intronic
990944609 5:61236707-61236729 GTGGGGAACATCACACACTGGGG + Intergenic
991183193 5:63778217-63778239 GTGGGGAACAACACATACTGGGG - Intergenic
991388070 5:66111889-66111911 GTGGGGGACATCACACACTGGGG + Intergenic
991635167 5:68697471-68697493 GTGGGGAACATCACACACTGGGG + Intergenic
992824241 5:80532189-80532211 GTGGGGAACATCCCACACCGGGG + Intronic
993024757 5:82632504-82632526 GTGGGGAACATCACACACTGGGG - Intergenic
993079025 5:83272599-83272621 GAGGGGAACATCACATACTGTGG - Intronic
993492464 5:88568902-88568924 GTGGGGAACATCACACACTGGGG + Intergenic
993528291 5:88993599-88993621 GTGGGGAACATCACACACTGGGG + Intergenic
994348746 5:98719752-98719774 GAGGGGAACATCACATACTGGGG + Intergenic
994529907 5:100956349-100956371 GGGGGGCACATGACATACTGAGG + Intergenic
994860988 5:105194094-105194116 GTGGGGAACATCACACACTGGGG - Intergenic
995007263 5:107214986-107215008 GTGGGGAACATCACACACTGGGG - Intergenic
995129103 5:108611304-108611326 GTGGGGAACATCACACACTGGGG - Intergenic
995252019 5:110004688-110004710 GTGGGGAACATCACACACTGAGG - Intergenic
995279602 5:110318319-110318341 GTGGGGAACATCACACACTGGGG + Intronic
995386353 5:111594024-111594046 GAGGGGAACATCACATACTGGGG + Intergenic
995618378 5:113993924-113993946 GAGGGGAACATCACATACTGGGG - Intergenic
995628975 5:114112298-114112320 GTGGGGAACATCACAGACTGGGG + Intergenic
995720266 5:115123215-115123237 GTGGGGAACATCACATACCGGGG + Intergenic
995758573 5:115539652-115539674 CTGTTGCACTTACCATACTGTGG + Intronic
995812885 5:116127746-116127768 GTGGAGAACATCACACACTGGGG + Intronic
996003937 5:118398381-118398403 GTGGGGAACATCACACACTGGGG - Intergenic
996041063 5:118811831-118811853 GTGGGGAACATCACACACTGGGG + Intergenic
996259599 5:121449699-121449721 GAGGGGAACATCCCACACTGGGG + Intergenic
996438863 5:123466880-123466902 GTGGGGAACATCACACACTGGGG - Intergenic
996481084 5:123975435-123975457 GTGGGGAACATCACACACTGGGG + Intergenic
996521312 5:124429094-124429116 GTGGGGAACATCACACACTGGGG + Intergenic
996936622 5:128956880-128956902 GTGGGGAACATCACACACTGGGG - Intronic
997301109 5:132806178-132806200 GTGGGGAACATCACATACCGGGG + Intronic
998281398 5:140811179-140811201 GTGGGGAACATCACACACTGGGG - Intronic
999665699 5:153910724-153910746 GTGGGGAACATCACACACTGGGG + Intergenic
999966242 5:156812608-156812630 GTGGGGAACATCACATACTGGGG + Intergenic
1000364601 5:160479126-160479148 GAGGGGAACATCACATACTGGGG - Intergenic
1000370597 5:160532278-160532300 GTGGGGAACATCACACACTGGGG - Intergenic
1000490415 5:161905876-161905898 GTGGGGAACATCACACACTGTGG + Intergenic
1000746490 5:165040557-165040579 GTGGGGAACATCACACACTGGGG - Intergenic
1001008695 5:168077598-168077620 GTGGGGAACATCACATACCGGGG - Intronic
1001682717 5:173570635-173570657 CTGGGGCACATCCGATCCTGCGG + Intergenic
1001850365 5:174958766-174958788 GAGGGGAACATCACATACTGGGG + Intergenic
1002686456 5:181014971-181014993 GTGGGGAACATCACACACTGGGG + Intergenic
1002893773 6:1362078-1362100 GTGGGGAACATCACACACTGGGG + Intergenic
1003165334 6:3672366-3672388 GTGGGGAACATCACATACTGGGG - Intergenic
1003691286 6:8356273-8356295 GTGGGGAACATCACACACTGGGG + Intergenic
1003842684 6:10138512-10138534 GTGGGGAACATCACACACTGGGG + Intronic
1003996705 6:11548894-11548916 GTGGAGAACATCACACACTGGGG + Intronic
1004730533 6:18353953-18353975 GTGGGGAACATCACACACTGGGG - Intergenic
1004937841 6:20525528-20525550 GTGGGGAACATCACACACTGGGG + Intergenic
1005009245 6:21320617-21320639 GAGGGGAACATCACATACTGGGG + Intergenic
1005838258 6:29723825-29723847 GTGGTCCACTCCCAATACTGCGG - Exonic
1005846653 6:29785645-29785667 GTGGGGAACATCACACACTGGGG + Intergenic
1005886531 6:30101809-30101831 CTGCAGCACATCCCAAACTGGGG + Intergenic
1006061698 6:31425388-31425410 GTGGAGAACATCACACACTGGGG - Intergenic
1006207498 6:32361050-32361072 GTGGGGAACATCACACACTGGGG - Intronic
1006222963 6:32510093-32510115 GTGGGGAACATCACACACTGGGG + Intergenic
1007338481 6:41172513-41172535 GTGGGGAACATCACACACTGGGG - Intergenic
1007581552 6:42963169-42963191 GGGGTGCACAGCCTGTACTGAGG - Exonic
1007773588 6:44210411-44210433 GTGGTGCACATCTGCTACTCAGG - Intergenic
1007987836 6:46224953-46224975 GTGGGGAACATCACACACTGGGG - Intronic
1008219981 6:48843583-48843605 GTGGGGAACATCACACACTGGGG - Intergenic
1008333780 6:50275108-50275130 GTGGGGAACATCACACACTGGGG - Intergenic
1008408321 6:51143945-51143967 GTGGGGAACATCACACACTGGGG + Intergenic
1008529436 6:52442466-52442488 GTGGGGAACATCACATACTGGGG - Intronic
1008737105 6:54558375-54558397 GTGGGGAACATCACACACTGTGG + Intergenic
1008763449 6:54881934-54881956 GTGGGGAACATCACACACTGGGG - Intronic
1009245111 6:61227891-61227913 GTGGGGAACATCACACACTGGGG + Intergenic
1009331364 6:62424964-62424986 GTGGAGAACATCACACACTGGGG + Intergenic
1009426615 6:63521053-63521075 GAGGTGAACATCATATACTGGGG + Intergenic
1009449039 6:63779918-63779940 GTGGGGAACATCACACACTGGGG - Intronic
1009466959 6:63982775-63982797 GTGGTGAACATACCCTACTATGG - Intronic
1009537100 6:64901210-64901232 GAGGGGAACATCACATACTGGGG + Intronic
1009647685 6:66427447-66427469 GTGGGGAACATCACACACTGGGG + Intergenic
1009708783 6:67290502-67290524 GTGGGGAACATCACATACCGGGG + Intergenic
1009999220 6:70931154-70931176 GTGGGGAACATCACACACTGGGG + Intronic
1010178556 6:73057298-73057320 GTGGGGAACATCACACACTGGGG + Intronic
1010182462 6:73103455-73103477 ATGGGGAACATCACATACTGGGG + Intronic
1010314899 6:74436580-74436602 GTGGGGAACATCACACACTGGGG - Intergenic
1010529210 6:76945874-76945896 GAGGGGAACATCACATACTGGGG + Intergenic
1010554052 6:77257482-77257504 GTGGGGAACATCACACACTGGGG + Intergenic
1010806103 6:80238771-80238793 GTGGGGAACATCACACACTGGGG - Intronic
1010975134 6:82303489-82303511 GTGGGGAACATCACACACTGGGG + Intergenic
1011002543 6:82607094-82607116 GTGGGGAACATCACACACTGGGG - Intergenic
1011145262 6:84207537-84207559 GTGGGGAACATCACACACTGAGG + Intronic
1011204742 6:84879390-84879412 GTGGGGAACATCACACACTGGGG - Intergenic
1011675705 6:89731579-89731601 GAGGGGAACATCACATACTGGGG + Intronic
1012123342 6:95394824-95394846 GTGGGGAACATCACACACTGGGG - Intergenic
1012204916 6:96449556-96449578 GTGGGGAACATCACACACTGGGG - Intergenic
1012287445 6:97409014-97409036 GTGGGGAACATCACACACTGGGG + Intergenic
1012667979 6:102001377-102001399 GAGGGGAACATCACATACTGGGG - Intronic
1012772288 6:103454186-103454208 GTGGGGAACATCACATACCGGGG - Intergenic
1013310703 6:108890926-108890948 GAGGGGCACATCACACACTGGGG - Intronic
1013900285 6:115147468-115147490 GTGGGGAACATCACACACTGGGG + Intergenic
1013964749 6:115941313-115941335 GAGGGGAACATCACATACTGGGG + Exonic
1014127950 6:117798851-117798873 GTGGGGAACATCACACACTGGGG - Intergenic
1014133731 6:117864240-117864262 GTGGGGAACATCACACACTGGGG - Intergenic
1014279378 6:119423895-119423917 GTGGGGAACATCCCACACTGGGG + Intergenic
1014448977 6:121561619-121561641 GTGGGGAACATCCCACACTGTGG - Intergenic
1014894281 6:126882938-126882960 GAGGGGAACATCACATACTGGGG - Intergenic
1015834786 6:137408707-137408729 GTGGGGAACATCACACACTGGGG - Intergenic
1015936959 6:138414040-138414062 GTGGTGGACATCACATAAGGTGG + Exonic
1016009195 6:139121229-139121251 GTGGGGAACATCACATACCGGGG - Intergenic
1016335335 6:142998793-142998815 GTGGGGAACATCACACACTGGGG - Intergenic
1016380089 6:143468844-143468866 GTGGGGAACATCACACACTGGGG - Intronic
1016585450 6:145679229-145679251 GTGGGGAACATCACACACTGGGG + Intronic
1016660148 6:146568985-146569007 GAGGGGAACATCACATACTGGGG + Intergenic
1016695194 6:146986025-146986047 GTGGGGAACAACACATACTGGGG - Intergenic
1017356587 6:153517005-153517027 GTGGGGAACATCACACACTGGGG - Intergenic
1017459904 6:154639207-154639229 GAGGGGAACATCACATACTGGGG - Intergenic
1017881551 6:158565882-158565904 GTGGGGCACTGCCCATCCTGCGG - Intronic
1017930722 6:158952362-158952384 GTGGTGAACATCACACACTGGGG + Intergenic
1018592433 6:165442314-165442336 GTGGGGAACATCACACACTGGGG - Intronic
1019670643 7:2276295-2276317 CTGGTCCACATCCCCGACTGCGG + Intronic
1020251634 7:6473447-6473469 GTGGCACACACCCCACACTGGGG - Intronic
1020348868 7:7196234-7196256 GTGGGGAACATCACACACTGGGG - Intronic
1020549938 7:9591114-9591136 GTGGGGAACATCACACACTGGGG - Intergenic
1020635741 7:10693957-10693979 GTGGGGAACATCACACACTGGGG + Intergenic
1020640958 7:10753035-10753057 GTGGGGAACATCACACACTGGGG + Intergenic
1021332799 7:19359369-19359391 GTGGGGAACATCACACACTGGGG + Intergenic
1021343566 7:19493248-19493270 GTGGGGAACATCACACACTGGGG - Intergenic
1022558465 7:31324853-31324875 GTGGGGAACATCACACACTGGGG + Intergenic
1022986481 7:35660048-35660070 GTGGGGAACATCACACACTGGGG - Intronic
1022999034 7:35788464-35788486 GTGGGGAACATCACACACTGGGG - Intergenic
1023051310 7:36254299-36254321 GAGGGGAACATCACATACTGGGG - Intronic
1023368034 7:39484570-39484592 GTGGGGAACATCACACACTGGGG - Intronic
1023457043 7:40350808-40350830 GAGGGGAACATCACATACTGGGG - Intronic
1023650682 7:42365613-42365635 GTGGGGAACATCACACACTGGGG - Intergenic
1024066101 7:45738024-45738046 GTGGGGAACATCACACACTGGGG + Intergenic
1024702943 7:51924399-51924421 GCGGGGAACATCACATACTGGGG - Intergenic
1027493114 7:78855425-78855447 GTGGGGAACATCACACACTGGGG - Intronic
1027935269 7:84593891-84593913 GAGGGGAACATCACATACTGGGG + Intergenic
1028013156 7:85675116-85675138 GTGGGGAACATCACACACTGGGG - Intergenic
1028019896 7:85757081-85757103 GTGGGGAACATCACACACTGGGG + Intergenic
1028403381 7:90448627-90448649 GTGGGGAACATCACACACTGGGG + Intronic
1028422972 7:90653838-90653860 GTGGGGAACATCACACACTGGGG - Intronic
1028432511 7:90763635-90763657 GTGGGGAACATCACACACTGGGG + Intronic
1028481269 7:91308470-91308492 GAGGGGAACATCACATACTGGGG + Intergenic
1028576631 7:92359242-92359264 GTGGGGAACATCACACACTGGGG - Intronic
1028720159 7:94020860-94020882 GTGGGGAACATCACACACTGTGG + Intergenic
1029053305 7:97712543-97712565 GTGGGGAACATCACACACTGGGG + Intergenic
1029880326 7:103801550-103801572 GTGGGGAACATCACACACTGGGG + Intronic
1029951141 7:104587290-104587312 GTGGGGAACATCACACACTGGGG - Intronic
1030492844 7:110259915-110259937 GTGGTGCAAATCCAATTCAGTGG - Intergenic
1030616620 7:111744143-111744165 GTGGTGCACATCCCATACTGAGG - Intronic
1030778535 7:113567565-113567587 GTGGGGAACATCACACACTGGGG + Intergenic
1030966123 7:115995167-115995189 GTGGGGAACATCACACACTGGGG + Intronic
1030970664 7:116051117-116051139 GTGGGGAACATCACACACTGGGG + Intronic
1031235818 7:119174843-119174865 GAGGGGAACATCACATACTGGGG - Intergenic
1031248001 7:119341519-119341541 GTGGGGAACATCACACACTGGGG + Intergenic
1031305184 7:120117172-120117194 GTGGGGAACATCACACACTGGGG + Intergenic
1031329566 7:120448200-120448222 GTGGGGAACATCACACACTGGGG - Intronic
1031467811 7:122135094-122135116 GTGGGGAACATCACACACTGGGG + Intronic
1031506626 7:122592807-122592829 GTGGGGAACATCACACACTGGGG + Intronic
1031779049 7:125939583-125939605 GTGGTGGACCTACCATTCTGGGG - Intergenic
1031783077 7:125994745-125994767 GTGGGGAACATCACACACTGGGG + Intergenic
1031900236 7:127401281-127401303 GAGGTCAACATCACATACTGGGG - Intronic
1032250101 7:130248877-130248899 GTGGGGAACATCACACACTGGGG - Intergenic
1032983657 7:137313876-137313898 ATGGTGAACATCCAATTCTGAGG - Intronic
1033001022 7:137505095-137505117 GGGGGGAACATCCCACACTGGGG + Intronic
1033046664 7:137968381-137968403 GAGGGGAACATCACATACTGGGG - Intronic
1033431961 7:141297527-141297549 GTGGGGAACATCACACACTGGGG - Intronic
1033802758 7:144920314-144920336 GTGGGGAACATCACACACTGGGG + Intergenic
1033902772 7:146162977-146162999 GTGGGGAACATCACACACTGGGG + Intronic
1033973906 7:147075802-147075824 GTGGGGAACATCACACACTGGGG - Intronic
1033996246 7:147353318-147353340 GAGGGGAACATCACATACTGGGG - Intronic
1034345366 7:150382317-150382339 GTGGTGCTCCTCCCAAACTCAGG + Intronic
1034361376 7:150502067-150502089 GCGGTGAACATCACACACTGGGG + Intergenic
1034370281 7:150589155-150589177 GTGGGGAACATCACACACTGGGG + Intergenic
1034714548 7:153229181-153229203 GAGGGGAACATCCCACACTGGGG - Intergenic
1035092080 7:156321436-156321458 GAGGGGAACATCACATACTGGGG - Intergenic
1035414188 7:158668942-158668964 GTGGGGAACAACACATACTGGGG - Intronic
1036978714 8:13444270-13444292 GTGGGGAACATCACACACTGGGG + Intronic
1036995482 8:13650482-13650504 GTGGGGAACATCACACACTGGGG + Intergenic
1037053833 8:14410579-14410601 GAGGGGAACATCACATACTGGGG + Intronic
1037368070 8:18144128-18144150 GAGGTTCACAGCCCATTCTGAGG - Intergenic
1037868285 8:22466008-22466030 GTGGGGAACATCACACACTGGGG - Intronic
1038141417 8:24849336-24849358 GTGGGGAACATCACACACTGGGG - Intergenic
1038221197 8:25609541-25609563 GTGGGGAACATCACACACTGGGG - Intergenic
1038681168 8:29669909-29669931 TTGGTGCTCTTCCCATAATGTGG - Intergenic
1039170928 8:34744006-34744028 GTGGGGAACATCACACACTGGGG + Intergenic
1039273940 8:35914255-35914277 GAGGGGAACATCACATACTGGGG + Intergenic
1039863786 8:41483059-41483081 GTGGGGAACATCACACACTGGGG + Intergenic
1041000590 8:53446640-53446662 GTGGGGAACATCACACACTGGGG + Intergenic
1041026738 8:53694363-53694385 GTGGGGAACATCACACACTGGGG - Intergenic
1041156341 8:54990975-54990997 GTGGGGAACATCACACACTGGGG + Intergenic
1041413037 8:57577625-57577647 ATAGTGCACACACCATACTGGGG - Intergenic
1041470114 8:58198739-58198761 GTGGGGAACATCACACACTGGGG - Intronic
1041614625 8:59892235-59892257 GTGGGGAACATCACACACTGGGG + Intergenic
1041772400 8:61485917-61485939 GTGGGGAACATCACACACTGGGG + Intronic
1041815363 8:61964491-61964513 GTGGTGAACATCACACACCGGGG - Intergenic
1041910441 8:63083456-63083478 GTGGGGAACATCGCACACTGGGG + Intronic
1042390312 8:68226887-68226909 GTAATGCATGTCCCATACTGGGG + Intronic
1042681728 8:71393466-71393488 GTGGGGAACATCACACACTGGGG - Intergenic
1042993054 8:74662405-74662427 GAGGCGAACATCACATACTGGGG + Intronic
1043279950 8:78450812-78450834 GTGGGGAACATCACACACTGGGG + Intergenic
1043884271 8:85580562-85580584 GTGGGGAACATCACACACTGGGG - Intergenic
1043889380 8:85639639-85639661 GTGGGGAACATCACACACTGGGG + Intergenic
1044007387 8:86955004-86955026 GTGGGGAACATCACACACTGGGG - Intronic
1044252794 8:90023888-90023910 GTGGGGAACACCACATACTGGGG - Intronic
1044596492 8:93964001-93964023 GTGGGGAACATCACACACTGGGG - Intergenic
1045162007 8:99558580-99558602 GTGGGGAGCATCACATACTGGGG - Intronic
1045234614 8:100339991-100340013 GAGGGGAACATCACATACTGGGG - Intronic
1045764208 8:105647548-105647570 GTGGGGAACATCACACACTGGGG - Intronic
1045923089 8:107555385-107555407 GTGGGGAACATCACACACTGGGG + Intergenic
1045968114 8:108049572-108049594 GGGGGGAACATCACATACTGGGG - Intronic
1046117196 8:109798674-109798696 GTGGGGAACATCACACACTGGGG - Intergenic
1046125388 8:109900290-109900312 GTGGGGAACATCACATACCGGGG - Intergenic
1046291243 8:112164612-112164634 GAGGGGAACATCACATACTGGGG - Intergenic
1046610328 8:116416270-116416292 GTGGGGAACATCACACACTGGGG + Intergenic
1046663539 8:116975004-116975026 GTGGGGAACATCACACACTGGGG + Intronic
1046992744 8:120478223-120478245 GAGGGGAACATCACATACTGGGG + Intronic
1047015804 8:120721909-120721931 GTGGGGAACATCACACACTGGGG - Intronic
1047633320 8:126731815-126731837 GTGGGGAACATCGCACACTGGGG - Intergenic
1047932079 8:129738625-129738647 GTGGGGAACATCACACACTGGGG + Intergenic
1047957249 8:129985245-129985267 GTGGTGCCCATCCCATCCGCTGG - Intronic
1048231879 8:132650338-132650360 GTGGGGAACATCACACACTGGGG + Intronic
1048664909 8:136650120-136650142 GTGGGGAACATCACACACTGGGG + Intergenic
1048858997 8:138709607-138709629 GTGGGGAACATCACACACTGGGG + Intronic
1049952780 9:661295-661317 GCGGTGAACATCACACACTGGGG - Intronic
1050013661 9:1210683-1210705 GTGGGGAACATCACATACCGGGG + Intergenic
1050829508 9:9992770-9992792 GTGGGGAACATCACACACTGGGG + Intronic
1050841136 9:10150481-10150503 GTGGGGAACATCACATACCGGGG + Intronic
1050888793 9:10797179-10797201 GAGGTGAACATCACACACTGGGG - Intergenic
1051481641 9:17568427-17568449 GTGGGGAACATCACACACTGGGG - Intergenic
1051549273 9:18311174-18311196 GAGGGGAACATCACATACTGAGG + Intergenic
1051727408 9:20102462-20102484 GAGGTGAACATCACACACTGGGG + Intergenic
1051801542 9:20939923-20939945 GTGGGGAACATCACACACTGGGG - Intronic
1052079599 9:24187801-24187823 GTGGGGAACATCACACACTGGGG + Intergenic
1052193807 9:25687951-25687973 GTGGGGAACATCACACACTGGGG - Intergenic
1052270437 9:26622873-26622895 GAGGGGAACATCACATACTGGGG + Intergenic
1052365824 9:27611133-27611155 GAGGGGAACATCACATACTGCGG - Intergenic
1052398149 9:27966540-27966562 GAGGGGAACATCCCACACTGGGG + Intronic
1053083680 9:35199031-35199053 GTGGGGAACATCACACACTGGGG - Intronic
1053186461 9:36020610-36020632 GAGGTTCACAGCCCATTCTGAGG + Intergenic
1053274704 9:36774392-36774414 GTGGAGAACATCACATACTGGGG - Intergenic
1053911684 9:42912791-42912813 GTGGGGAACATCACATACCGGGG + Intergenic
1053941983 9:43260365-43260387 GAGGGGAACATCACATACTGGGG - Intergenic
1054997909 9:71413068-71413090 GTGGGGAACATCACACACTGGGG + Intronic
1055358188 9:75459889-75459911 GTGGGGAACATCACACACTGGGG + Intergenic
1055863664 9:80786282-80786304 GTGGGGAACATCACACACTGGGG + Intergenic
1055936179 9:81606596-81606618 GTGGGGAACATCACACACTGGGG + Intronic
1056116156 9:83443311-83443333 GCGGGGTACATCACATACTGGGG - Intronic
1056417969 9:86395940-86395962 GTGGGGAACATCACACACTGGGG + Intergenic
1056425758 9:86474906-86474928 GTGGGGAACATCACACACTGGGG - Intergenic
1057012174 9:91614411-91614433 GTGGGGAACATCACACACTGGGG + Intronic
1057120464 9:92568256-92568278 GTGGGGAACATCACACACTGGGG - Intronic
1058029823 9:100183094-100183116 GAGGGGAACATCACATACTGGGG + Intronic
1058075470 9:100646052-100646074 GTGGGGAACATCACACACTGGGG - Intergenic
1058400684 9:104615487-104615509 GTGGGGAACATCACACACTGGGG + Intergenic
1058631751 9:106995986-106996008 GTGGGGAACATCACACACTGGGG - Intronic
1058726379 9:107808575-107808597 GAGGGGAACATCACATACTGGGG + Intergenic
1059317394 9:113437733-113437755 GTGGGGAACATCACACACTGGGG - Intergenic
1059500902 9:114753265-114753287 GTGGGGAACATCACACACTGGGG + Intergenic
1059875017 9:118625110-118625132 GAGGGGAACATCACATACTGGGG - Intergenic
1061515749 9:131089145-131089167 GTGGGGAACATCACACACTGGGG + Intronic
1061896085 9:133648568-133648590 GTGGTGAAAACCCCATCCTGTGG - Intronic
1186541509 X:10405856-10405878 GTGGGGAACATCACACACTGGGG + Intergenic
1187373965 X:18734299-18734321 GTGGGGAACATCACACACTGGGG - Intronic
1187778933 X:22795369-22795391 GAGGGGAACATCACATACTGGGG + Intergenic
1188017044 X:25117311-25117333 GTGGGGAACATCACACACTGGGG - Intergenic
1188150833 X:26673100-26673122 GTGGGGAACATCACACACTGGGG - Intergenic
1188271451 X:28146554-28146576 GTGGAGAACATCACACACTGGGG - Intergenic
1188272448 X:28157332-28157354 GTGGGGAACATCACACACTGGGG + Intergenic
1189051570 X:37650900-37650922 GTGGGGAACATCACACACTGGGG - Intronic
1189508935 X:41641916-41641938 GTGGGGAACATCACACACTGGGG - Intronic
1189661449 X:43304234-43304256 GTGGGGAACAACACATACTGGGG - Intergenic
1190534690 X:51414160-51414182 GTGGGGAACATCACACACTGGGG + Intergenic
1190911654 X:54776851-54776873 GTGATGCACATTCCAAGCTGCGG + Intronic
1191023265 X:55885873-55885895 GTGGGGAACATCGCACACTGGGG - Intergenic
1191043582 X:56112302-56112324 GAGGTGAACATCACACACTGGGG + Intergenic
1191065954 X:56348047-56348069 GTGGGGAACATCACACACTGGGG - Intergenic
1191094850 X:56663073-56663095 GTGGGGAACATCACACACTGGGG - Intergenic
1191642816 X:63446629-63446651 GTGGGGAACATCACACACTGGGG - Intergenic
1191777667 X:64834244-64834266 GAGGGGAACATCACATACTGGGG - Intergenic
1191804187 X:65116736-65116758 GTGGGGAACATCACACACTGAGG - Intergenic
1191808992 X:65166215-65166237 GTGGGGAACATCACACACTGGGG - Intergenic
1191847968 X:65562896-65562918 GTGGGGAACATCACACACTGGGG - Intergenic
1192285604 X:69732271-69732293 GTGGGGAACATCACACACTGGGG - Intronic
1192475817 X:71441838-71441860 GTGGGGAACATCACATACTGGGG - Intronic
1192523501 X:71822644-71822666 GTGGGGAACATCACACACTGGGG + Intergenic
1192801079 X:74465559-74465581 GTGGTGCTCAGCCCATTTTGTGG + Intronic
1192826455 X:74701676-74701698 GTGGGGAACATCACACACTGGGG + Intergenic
1192837754 X:74820157-74820179 GTGGGGAACATCACACACTGGGG + Intronic
1192856849 X:75021101-75021123 GTGGGGAACATCCCACACTGGGG - Intergenic
1192973273 X:76255540-76255562 GTGGGGAACATCACACACTGAGG - Intergenic
1193002074 X:76574018-76574040 GTGGTGAACACCACACACTGGGG + Intergenic
1193101023 X:77612388-77612410 GAGGGGCACATCACATACTGGGG + Intronic
1193157209 X:78186849-78186871 GTGGGGAACATCACACACTGGGG + Intergenic
1193610271 X:83623138-83623160 GTGGGGAACATCACACACTGAGG - Intergenic
1193710141 X:84869752-84869774 GTGGGGAGCATCACATACTGGGG + Intergenic
1193781807 X:85712087-85712109 GTGGGGAACATCACACACTGGGG - Intergenic
1194677287 X:96809688-96809710 GTGGGGCACATCACACACTGGGG - Intronic
1194782594 X:98043555-98043577 GAGGGGAACATCCCATACTGTGG - Intergenic
1194900881 X:99510187-99510209 GAGGTGAACATCACACACTGGGG - Intergenic
1194990025 X:100537298-100537320 GTGGGGAACATCACACACTGGGG - Intergenic
1195249491 X:103029280-103029302 GTGGGGAACATCACACACTGGGG + Intergenic
1195267655 X:103198695-103198717 GTGGGGAACATCACACACTGGGG - Intergenic
1195435299 X:104836911-104836933 GAGGGGAACATCACATACTGGGG - Intronic
1195518600 X:105805656-105805678 GAGGTGAACATCACACACTGGGG - Intergenic
1196203660 X:112914553-112914575 GTGGGGAACATCACACACTGGGG - Intergenic
1196269262 X:113692104-113692126 GAGGGGAACATCACATACTGGGG - Intergenic
1196304224 X:114082581-114082603 GTGGGGAACATCACACACTGGGG - Intergenic
1196471464 X:116033341-116033363 GTGGGGAACATCACACACTGGGG + Intergenic
1196508128 X:116473676-116473698 GAGGGGAACATCACATACTGGGG - Intergenic
1196527771 X:116747459-116747481 GTGGGGAACATCACACACTGGGG - Intergenic
1196561889 X:117159608-117159630 GAGGGGAACATCACATACTGGGG + Intergenic
1196711026 X:118762995-118763017 GAGGTGAACAACACATACTGGGG + Intronic
1196979221 X:121193202-121193224 GTGGGGAACATCACACACTGGGG - Intergenic
1197478532 X:126952696-126952718 GTGGGGAACATCACATACCGGGG + Intergenic
1197644448 X:129003000-129003022 GTGGGGAACATCACACACTGGGG + Intergenic
1197672529 X:129293902-129293924 GTGGGGAACATCACATACTGGGG + Intergenic
1197711259 X:129670924-129670946 GTGGGGAACATCACACACTGGGG - Intergenic
1198050410 X:132946587-132946609 GTGGGGAACATCACACACTGGGG + Intronic
1198124304 X:133627134-133627156 GTGGGGAACATCACACACTGAGG + Intronic
1198522623 X:137468440-137468462 GTGGGGAACATCACACACTGGGG - Intergenic
1199027147 X:142953425-142953447 GAGGGGAACATCACATACTGGGG - Intergenic
1199292961 X:146125154-146125176 GTGGGGAACATCGCACACTGGGG + Intergenic
1199640446 X:149856131-149856153 GTGGGGAACATCACACACTGGGG - Intergenic
1199645513 X:149906555-149906577 GTGGGGAACATCACATACCGGGG + Intergenic
1199780811 X:151057609-151057631 GTGGGGAACATCACACACTGGGG - Intergenic
1200356234 X:155555052-155555074 GTGGGGAACATCACACACTGGGG - Intronic
1200359087 X:155583142-155583164 GTGGGGAACATCACACACTGGGG + Intronic
1200364513 X:155647477-155647499 GTGGGGAACATCACACACTGGGG - Intronic
1200732133 Y:6753568-6753590 GAGGGGAACATCCCACACTGGGG - Intergenic
1200771531 Y:7129988-7130010 GTGGAGAACATCACACACTGGGG - Intergenic
1200826975 Y:7656647-7656669 GTGGGGAACATCACACACTGGGG - Intergenic
1201336734 Y:12889559-12889581 GAGGGGAACATCCCACACTGGGG - Intergenic
1201354001 Y:13077717-13077739 GTGGGGAACATCACACACTGGGG + Intergenic
1201386636 Y:13447144-13447166 GAGGGGAACATCACATACTGGGG - Intronic
1201492829 Y:14561251-14561273 GAGGGGAACATCACATACTGGGG - Intronic
1202253494 Y:22896568-22896590 GTGGGGAACATCACACACTGGGG - Intergenic
1202406484 Y:24530317-24530339 GTGGGGAACATCACACACTGGGG - Intergenic
1202464298 Y:25139764-25139786 GTGGGGAACATCACACACTGGGG + Intergenic