ID: 1030616622

View in Genome Browser
Species Human (GRCh38)
Location 7:111744162-111744184
Sequence CAAGGTTGCTACCTTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030616622_1030616627 0 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616627 7:111744185-111744207 GGCCAAGTGGCTCTCTGCAGTGG No data
1030616622_1030616630 16 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616630 7:111744201-111744223 GCAGTGGAGGCAATCCCTGAAGG 0: 1
1: 2
2: 5
3: 37
4: 205
1030616622_1030616631 17 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616631 7:111744202-111744224 CAGTGGAGGCAATCCCTGAAGGG No data
1030616622_1030616629 3 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG No data
1030616622_1030616632 29 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616632 7:111744214-111744236 TCCCTGAAGGGCCTGACAGCTGG 0: 1
1: 0
2: 7
3: 31
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030616622 Original CRISPR CAAGGTTGCTACCTTCTCAG TGG (reversed) Intronic
901189967 1:7403906-7403928 CAAGGTCTCTGGCTTCTCAGTGG + Intronic
902666016 1:17938923-17938945 CAAGGTTGCTACACTCACACTGG - Intergenic
903535309 1:24062869-24062891 CAAGGTTCCCACCTTCCCTGGGG + Intronic
904147292 1:28403372-28403394 GAAGGTCACAACCTTCTCAGGGG - Intronic
904469716 1:30728846-30728868 CAATTTTGCTGCCATCTCAGTGG - Intergenic
906712824 1:47944246-47944268 CAAGGTTGCTCTCTTTTCATAGG - Intronic
907325610 1:53637038-53637060 GAAGGATGCTGCCTCCTCAGTGG + Intronic
907555610 1:55341495-55341517 CAAGTTTGCTACTGTCTCACTGG + Intergenic
907743423 1:57189358-57189380 CTAGGTTGCTACCTTCCCTGGGG - Intronic
908284747 1:62583138-62583160 CAAAGTTACTCACTTCTCAGTGG - Intronic
911250752 1:95573701-95573723 TAAGGTTGCTGCCTTCACAAAGG - Intergenic
916923976 1:169498316-169498338 CAAGGTTGGGGGCTTCTCAGGGG + Intergenic
917637951 1:176955352-176955374 CAAGTTTCTGACCTTCTCAGTGG + Intronic
917805880 1:178613474-178613496 GAAGCTTGCTGCCTTCTCTGAGG - Intergenic
920453949 1:206083470-206083492 CGAGATTGCTATCTTCTGAGTGG + Intronic
924786480 1:247204520-247204542 CAAAGCTGCTTCCATCTCAGAGG - Intergenic
1062913223 10:1227700-1227722 CATGGTTGCTACCATCACAAGGG + Intronic
1063715305 10:8520886-8520908 CAGGGTTGGTTCCTTCTGAGGGG + Intergenic
1065153669 10:22848283-22848305 AAAGGTGGCTAGCTTGTCAGAGG - Intergenic
1067509772 10:46885151-46885173 CATGGCTGCCTCCTTCTCAGAGG - Intergenic
1067652482 10:48166707-48166729 CATGGCTGCCTCCTTCTCAGAGG + Intronic
1071093359 10:81945988-81946010 CAAGGTTGGTTCTTTCTGAGAGG - Intronic
1074714668 10:116207220-116207242 CAGGGTTGCGACCTTTGCAGGGG - Intronic
1080480678 11:32646566-32646588 CAAGGTTTCAGACTTCTCAGTGG - Intronic
1081952511 11:47056831-47056853 CCAGGTACCTACCTACTCAGTGG + Intronic
1082179155 11:49097923-49097945 CAAGGTTGTTTCTTTCTGAGAGG + Intergenic
1083205567 11:61146776-61146798 CAAGTGTTCTTCCTTCTCAGGGG - Intronic
1086686131 11:89734999-89735021 CAAGGTTGTTTCTTTCTGAGAGG - Intergenic
1087798497 11:102479088-102479110 AAAGGTTGCTTCCTCTTCAGAGG - Intronic
1088513140 11:110598953-110598975 CAAGGCTCCTACCTGCTCTGTGG - Intronic
1090500543 11:127256714-127256736 CAGGTTTGCTACCTTGTCTGAGG - Intergenic
1092335267 12:7627683-7627705 GAAGATTTCTTCCTTCTCAGGGG + Intergenic
1092978799 12:13772752-13772774 CAAGTTTGCAACCTTGTAAGAGG + Intronic
1093087137 12:14878620-14878642 CAAGATTGACACATTCTCAGAGG + Intronic
1097990404 12:65826127-65826149 CAGGGTCGCTTCCTTGTCAGGGG + Intronic
1100442908 12:94633700-94633722 CAAGCTTATTAACTTCTCAGTGG - Intronic
1100605434 12:96148641-96148663 CAAGGTTACTGCCCTCACAGAGG + Intergenic
1103624054 12:122205342-122205364 CAGGGTCGCTGCCCTCTCAGAGG - Intronic
1106014007 13:25850996-25851018 GAAGGATGCTATCTTTTCAGAGG + Intronic
1107727174 13:43310480-43310502 CAAGACAGCTGCCTTCTCAGAGG - Intronic
1108246429 13:48519096-48519118 CAAGATCACTAGCTTCTCAGTGG + Intronic
1108732649 13:53250948-53250970 CAAGTTTTCTAGTTTCTCAGAGG + Intergenic
1113183508 13:107659327-107659349 CTAGATTGCTGCCTTATCAGTGG + Intronic
1113670039 13:112170395-112170417 CAAGGGTGCAGGCTTCTCAGTGG - Intergenic
1119444976 14:74655501-74655523 CAAGATTGTAAGCTTCTCAGAGG + Intronic
1121023318 14:90595653-90595675 CAAGTTGGCTACCTTCTCATTGG + Intronic
1122835929 14:104431045-104431067 AAAGGGTGCTGCCTCCTCAGTGG - Intergenic
1128248106 15:66146835-66146857 GAAGGTAGGCACCTTCTCAGGGG + Intronic
1131355167 15:91738972-91738994 CAGGCTTGCTTCCTTGTCAGTGG - Intergenic
1136463654 16:30427617-30427639 AAAGGTTTCCACCTTCACAGTGG - Intronic
1137326767 16:47446464-47446486 CAATGTTTCTACCTTCCTAGGGG + Intronic
1137505731 16:49052317-49052339 CAAGGTTGTTGGCCTCTCAGGGG + Intergenic
1139154083 16:64419977-64419999 CAAGGTCTTTAACTTCTCAGTGG - Intergenic
1140301171 16:73758683-73758705 CAGGGTTGCTTCCTTCTCACTGG + Intergenic
1140752698 16:78040299-78040321 CAGGGTTGGTTCCTTCTAAGGGG + Intronic
1141406906 16:83802667-83802689 CAGCGTTGCTACCCTCTCAAGGG - Intergenic
1142614876 17:1128239-1128261 CAGGGTTCCTGCCTTCTCCGAGG - Intronic
1144058551 17:11561561-11561583 CAAGGTTGGAACTTTCTAAGAGG - Exonic
1147451336 17:40506595-40506617 CACCTCTGCTACCTTCTCAGGGG - Intergenic
1148456360 17:47813535-47813557 CAAGGCTGCTTCCTTCTCCCTGG - Intronic
1152080820 17:78186460-78186482 ACTGGTTGCCACCTTCTCAGAGG + Intronic
1152477752 17:80529206-80529228 TAAGGTGGCCACCTTCCCAGGGG + Intergenic
1153759468 18:8316819-8316841 CTCACTTGCTACCTTCTCAGTGG - Intronic
1158163511 18:54513034-54513056 AAAAGTTACTACCTTTTCAGGGG + Intergenic
1158581838 18:58690728-58690750 CAGCGTTGCCGCCTTCTCAGGGG + Intronic
1161358743 19:3834352-3834374 CCAGATTCCTACCTTCTAAGAGG - Intronic
1165994872 19:39836878-39836900 CATGGTTGCCACCTACTCTGTGG + Intronic
1166626358 19:44359699-44359721 TAAGGTTTCTATCTTCTCAGTGG + Intronic
1166716298 19:44970293-44970315 CCTGGTTCCTTCCTTCTCAGGGG + Intronic
925821395 2:7802905-7802927 AAGGGTTGCTAACTTCTAAGAGG - Intergenic
926343149 2:11921460-11921482 CAATGCTGTAACCTTCTCAGTGG - Intergenic
929111014 2:38405084-38405106 ACATGTTGCCACCTTCTCAGAGG - Intergenic
929511595 2:42569094-42569116 CAAGAAGGCCACCTTCTCAGGGG - Intronic
929781252 2:44958517-44958539 GAAGGCTGCTCCCTCCTCAGTGG + Intergenic
930683327 2:54280876-54280898 CAATGATGCTACCCACTCAGTGG - Intronic
934151540 2:89152106-89152128 CAAGTTTCCTCCCTTCTCAGTGG - Intergenic
934215721 2:90029800-90029822 CAAGTTTCCTCCCTTCTCAGTGG + Intergenic
935048110 2:99499665-99499687 TAATGTTGCCACCTCCTCAGAGG + Intergenic
936723389 2:115281420-115281442 AAAGGTTGCTTCTTCCTCAGTGG + Intronic
937675771 2:124588485-124588507 CAAGGCTTGAACCTTCTCAGTGG - Intronic
943424710 2:187716422-187716444 TAATGGTACTACCTTCTCAGAGG + Intergenic
944052069 2:195481025-195481047 CAGGGTTGATTCCTTCTGAGGGG - Intergenic
944450133 2:199834248-199834270 CAGGGTTGGTTCCTTCTGAGAGG - Intronic
945026613 2:205625472-205625494 GAAGGTAGCAACTTTCTCAGTGG + Intergenic
947978847 2:234391062-234391084 CAAGGTGGCTACCTTTGCTGAGG - Intergenic
1170024339 20:11872727-11872749 CAAGGGTTCTACTCTCTCAGTGG + Intergenic
1175584294 20:60125777-60125799 CATGGTTGATCCCTTCTAAGAGG - Intergenic
1177507048 21:22032922-22032944 CAAGCTCTCAACCTTCTCAGGGG - Intergenic
1178683351 21:34692164-34692186 CAACGGTGACACCTTCTCAGAGG - Intronic
1181868778 22:25881253-25881275 CAAGGCTTCTGCCTTCTCCGTGG - Intronic
1182114899 22:27750757-27750779 CTAGGTTGGTACCTGCTTAGTGG - Exonic
1183802886 22:40182875-40182897 CCAGGTTGCAAAGTTCTCAGAGG - Intronic
1185009523 22:48305434-48305456 CAAGGTTGCTGCCTCCTCTGAGG + Intergenic
949184218 3:1170836-1170858 CAAGGTTTGTAACTTGTCAGAGG - Intronic
950270224 3:11608775-11608797 CAAGATTGCTTCTTTTTCAGTGG + Intronic
954393165 3:50278113-50278135 CAAGCTTGTTACCACCTCAGGGG - Intergenic
954953051 3:54491895-54491917 AAAGGGTGCTACCTTCTCACTGG - Intronic
955703540 3:61705393-61705415 CAAGGCTGCTATTTTGTCAGGGG + Intronic
955708656 3:61755341-61755363 CAAGGCTGATTCCTCCTCAGTGG - Intronic
955884125 3:63579251-63579273 CAGGCTTGCTCCCATCTCAGGGG + Intronic
956190860 3:66607057-66607079 CATGGTTGCTAACATCTCATTGG - Intergenic
960121146 3:113949304-113949326 GAAAGTTCCTGCCTTCTCAGAGG + Intronic
966815646 3:183887623-183887645 CAAGGTTGGTACCACCTAAGTGG - Intergenic
968024434 3:195427409-195427431 CAAAGGTGATACCTTCTCGGAGG + Intronic
969925569 4:10582609-10582631 CAAGGTCAATACCTTCTCGGAGG - Intronic
970111094 4:12639076-12639098 CAAGGTCCCTACCTTTGCAGAGG - Intergenic
972328042 4:38036659-38036681 TAAGGTTTCTACCTTCTAGGTGG + Intronic
974637869 4:64589170-64589192 CAACGTTGCTTTCTTCTCAGTGG - Intergenic
977121906 4:93112744-93112766 CAAGGTTGATTCCTTCTGAGGGG + Intronic
977366663 4:96077860-96077882 CAGGGTTGATTCCTTCTAAGAGG + Intergenic
986095829 5:4553411-4553433 CACCTTTGCTCCCTTCTCAGTGG + Intergenic
988335159 5:29898136-29898158 CAAGGTGGCTGCCTTCTCTCTGG - Intergenic
990446650 5:55899445-55899467 GAAGCTGGCTCCCTTCTCAGAGG + Intronic
992483429 5:77173447-77173469 CAAAATTGCTTCATTCTCAGAGG + Intergenic
993745229 5:91589002-91589024 CAAGGATGCCACCTTCTCTGGGG + Intergenic
993868492 5:93222530-93222552 CAAGATTTCTACCTACTCAGTGG + Intergenic
998792194 5:145777727-145777749 CAGGGTTTCTACCTGCTCCGTGG - Intronic
999252708 5:150192049-150192071 CTAGGTTGCTACCTCCTCTCAGG + Intronic
999468322 5:151828367-151828389 AGAGGTTGGTAACTTCTCAGAGG + Intronic
999655743 5:153808787-153808809 GATGGTTACTACCTTCTCACTGG - Intronic
1008375618 6:50787806-50787828 CAAGCTCTCTCCCTTCTCAGGGG - Intergenic
1008691529 6:53984507-53984529 CAAGGTTGGAACCTACTCATAGG + Intronic
1009537188 6:64902737-64902759 CAACATCTCTACCTTCTCAGGGG - Intronic
1010778185 6:79910453-79910475 CAAGGTAGTTACCTTCCAAGGGG - Intergenic
1014605313 6:123466597-123466619 CTAGGTTTCTACTTTCTCGGTGG + Intronic
1015664096 6:135608217-135608239 CAAGTTTGCTACATTCTCAGTGG - Intergenic
1018633769 6:165843111-165843133 CAAAGTCACTTCCTTCTCAGGGG - Intronic
1019815099 7:3193935-3193957 CACGTCTGCTACCTACTCAGTGG - Intergenic
1020907851 7:14087577-14087599 CCCAGTTGCTATCTTCTCAGAGG + Intergenic
1024270205 7:47636052-47636074 CATGAATGCTGCCTTCTCAGGGG - Intergenic
1030616622 7:111744162-111744184 CAAGGTTGCTACCTTCTCAGTGG - Intronic
1030943743 7:115690151-115690173 CAAGCTTGCAACCTGCTGAGTGG + Intergenic
1033839329 7:145354839-145354861 GAAGGTTGCTACCTCTTCTGGGG + Intergenic
1038851633 8:31283832-31283854 TTAAGTTGCTACTTTCTCAGTGG + Intergenic
1038851864 8:31286558-31286580 CAAGGTTTCTACCTATTAAGTGG - Intergenic
1044750298 8:95409292-95409314 CATGGTTGCTTCCTTCACATGGG - Intergenic
1046771175 8:118118147-118118169 CTTGTTTGCTTCCTTCTCAGCGG - Intergenic
1047434595 8:124825685-124825707 CAAGTTACCTACCCTCTCAGGGG - Intergenic
1049173343 8:141175625-141175647 TAAGGCTGATACCTTCTCAGTGG + Intronic
1051676908 9:19567712-19567734 GAAGGTTGATAAATTCTCAGTGG + Intronic
1053431293 9:38043474-38043496 AAAGGTGGCTGCCTTCACAGCGG - Intronic
1056250818 9:84746151-84746173 AATGGTTTCTACCTTCTAAGTGG + Intronic
1058704304 9:107626011-107626033 CAAGTTTCTTACCTTCTCTGTGG + Intergenic
1059893695 9:118835198-118835220 CAAGGTTGCTACTTAATTAGTGG + Intergenic
1062543502 9:137051843-137051865 CAAGGCTGCTGCCTGCTGAGAGG + Intronic
1189094839 X:38127092-38127114 CAAGTGATCTACCTTCTCAGTGG - Exonic
1189513188 X:41684120-41684142 CAAGGATGCTAACTTGTGAGTGG + Intronic
1200020873 X:153206511-153206533 CAAAGTTCCTACCGTCTAAGTGG - Intergenic