ID: 1030616629

View in Genome Browser
Species Human (GRCh38)
Location 7:111744188-111744210
Sequence CAAGTGGCTCTCTGCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030616620_1030616629 22 Left 1030616620 7:111744143-111744165 CCTCAGTATGGGATGTGCACCAC 0: 1
1: 0
2: 1
3: 43
4: 932
Right 1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG No data
1030616622_1030616629 3 Left 1030616622 7:111744162-111744184 CCACTGAGAAGGTAGCAACCTTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030616629 Original CRISPR CAAGTGGCTCTCTGCAGTGG AGG Intronic
No off target data available for this crispr