ID: 1030624879

View in Genome Browser
Species Human (GRCh38)
Location 7:111833283-111833305
Sequence TGTAATCTGAGTACTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030624876_1030624879 -2 Left 1030624876 7:111833262-111833284 CCAGGCATGGTGGCTCATGCCTG 0: 8252
1: 39501
2: 100261
3: 172981
4: 199558
Right 1030624879 7:111833283-111833305 TGTAATCTGAGTACTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030624879 Original CRISPR TGTAATCTGAGTACTTTAGG AGG Intronic
No off target data available for this crispr