ID: 1030626238

View in Genome Browser
Species Human (GRCh38)
Location 7:111848909-111848931
Sequence GCAGATAAAGGGATGGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030626238 Original CRISPR GCAGATAAAGGGATGGTCAA TGG (reversed) Intronic
903432580 1:23318284-23318306 GCAGGAAAAGGGATTGTTAATGG + Intronic
909386476 1:75063376-75063398 GTAGATGTAGGGATGGTTAATGG - Intergenic
910103934 1:83610263-83610285 GCATATAAAGTAATGTTCAAAGG - Intergenic
910371520 1:86521273-86521295 GGAGATAACAGGAGGGTCAAGGG + Intergenic
910520654 1:88118450-88118472 GCACGTAGAGGGCTGGTCAAGGG - Intergenic
910695829 1:90014524-90014546 GCTAATTAAGGAATGGTCAAAGG + Intronic
912933417 1:113983323-113983345 GAAGATAAAGGGAGGCTCACAGG - Intergenic
913562495 1:120035858-120035880 GAAGATACAGAGATAGTCAATGG - Intronic
913635627 1:120757749-120757771 GAAGATACAGAGATAGTCAATGG + Intergenic
914283089 1:146195239-146195261 GAAGATACAGAGATAGTCAATGG - Intronic
914544119 1:148645959-148645981 GAAGATACAGAGATAGTCAATGG - Intronic
914622510 1:149425053-149425075 GAAGATACAGAGATAGTCAATGG + Intergenic
915037418 1:152940687-152940709 GTAGACAAGGGGATGGGCAAGGG + Intergenic
915534684 1:156528230-156528252 GCAGATAAAGAGATGGTGTGGGG - Intronic
916504992 1:165420670-165420692 GGAGATACAGGGATGGTGATGGG - Intronic
916875544 1:168964656-168964678 GCAGATTAGGGGAAGGCCAAAGG - Intergenic
917611737 1:176695711-176695733 GGAGATAAAGGGATGGAGATGGG - Intronic
919525594 1:198645705-198645727 GCAGATAAAGGGATAGTTTAAGG + Intronic
919610141 1:199735403-199735425 GCTGAGTAAGGGATGTTCAAGGG - Intergenic
920805347 1:209228590-209228612 GTTGATAATGGGATGGTTAAAGG + Intergenic
922136106 1:222828526-222828548 ACACATGAAGGAATGGTCAAGGG - Intergenic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943734 10:1444442-1444464 GTAGATAGATGGATGATCAATGG - Intronic
1065843563 10:29726279-29726301 GCAGAGATAGGGATGGTTAGAGG + Intronic
1067411208 10:46066196-46066218 GCACATAAAAAGATGTTCAATGG + Intergenic
1069226351 10:65949886-65949908 CCAGGTAAAGGGATGGCCACTGG + Intronic
1069270723 10:66524093-66524115 GCAGAAAAAGGGATGGAGCAAGG - Intronic
1069435538 10:68379035-68379057 TCAGATAAACAGATGGTGAATGG + Intronic
1069765751 10:70857589-70857611 GCAGAGAAAGGTAAGGTCACTGG - Intronic
1071209630 10:83324113-83324135 GCATAGACAGGGATGGTTAAAGG + Intergenic
1071973628 10:90933002-90933024 GAAAATAAAGGGATAGACAAAGG + Intergenic
1072061289 10:91813458-91813480 CCAGATAAAGGCATGGTGGAAGG + Intronic
1072621381 10:97081643-97081665 GCACAGACAGGGATGCTCAAAGG + Intronic
1072877965 10:99193571-99193593 GAAAATAAAGGGATAGTAAAAGG + Intronic
1073205855 10:101768995-101769017 GCAGAGAAGGGAATGGGCAAGGG - Intergenic
1075673788 10:124281953-124281975 GCAGGCAAAGGCATGGGCAACGG + Intergenic
1080181591 11:29432340-29432362 GGAGATAGAGGGATGGTTTAGGG - Intergenic
1081090886 11:38865270-38865292 TCAGGTAAAGGGATGGAAAAAGG - Intergenic
1083091939 11:60208829-60208851 GCAGATCAAGAATTGGTCAAGGG - Intronic
1083100990 11:60305943-60305965 GCAGATCAAGAATTGGTCAAGGG + Intronic
1087382015 11:97417213-97417235 GCAAATAAAGTGATGGGGAAAGG - Intergenic
1087642251 11:100767805-100767827 ACAAATAAAGGGGTGTTCAATGG + Intronic
1088273812 11:108063167-108063189 GGAGAAATAGGGATGGTTAATGG - Intronic
1088930427 11:114345763-114345785 GGAGAAAAAGGGTTGGTCAAAGG + Intergenic
1090157953 11:124461296-124461318 GCAGCTATAGGGATGTTCCATGG + Intergenic
1093054583 12:14543131-14543153 ACAAATAAAGGGATAGTAAATGG - Intronic
1095725034 12:45442388-45442410 GCAGAAATGGGGATGGTTAATGG + Intergenic
1097629020 12:62036495-62036517 TCAGATAAATGAATGGACAATGG - Intronic
1102233999 12:111282822-111282844 ACAGAAAAAGGAATGGTCAATGG + Intronic
1103114618 12:118316246-118316268 GCAGTTAAAGGGAAGTTAAAAGG - Intronic
1103326060 12:120121500-120121522 ACAGATAAAGAGATGGTCCCTGG - Intergenic
1110904936 13:80875118-80875140 GGAGATAAAGGGAGTGTTAAAGG + Intergenic
1111486965 13:88915890-88915912 GGAGATCAAGAGAGGGTCAAAGG + Intergenic
1112708445 13:102099220-102099242 GAAGATAAATGGATGGAAAAAGG + Intronic
1112750163 13:102575047-102575069 GAAGATAAAGAAATGGCCAATGG - Intergenic
1115121947 14:29947499-29947521 GCAGCTAAAGGAATGGTGAGAGG + Intronic
1115431630 14:33325752-33325774 GCAGAAATAGGGATGGTTAATGG - Intronic
1116844351 14:49851447-49851469 GCAGATAAAATGAAGGTAAAGGG - Intronic
1117949180 14:61063948-61063970 CCAGATAAGGGAATGGACAAAGG - Intronic
1118073746 14:62275960-62275982 GAAAATAAAGGAATGGGCAAAGG - Intergenic
1120044110 14:79787546-79787568 GCTGAGAAAGGAAAGGTCAATGG - Intronic
1120263736 14:82222404-82222426 GCAGCTAAATTGATGGTCAGAGG + Intergenic
1120384960 14:83833029-83833051 GGAGATACAGAGATGTTCAAAGG + Intergenic
1120625993 14:86827101-86827123 GCAGTTAAAGTTATGGGCAAGGG + Intergenic
1121611836 14:95286466-95286488 GGAGATAGAGGGATGGTAAATGG + Intronic
1124996805 15:34731632-34731654 GCAGAGGAAGGGATGGTAATAGG + Intergenic
1126225549 15:46264465-46264487 GCAGACTAAGGGGTGGACAAAGG + Intergenic
1126667209 15:51086335-51086357 CCAGATCAGGGGATGGTAAAGGG - Intronic
1127124507 15:55799206-55799228 GAAGATAAAGGGAGGGAAAAGGG - Intergenic
1127326732 15:57903150-57903172 AAAGAGAAAGGGATGGTGAATGG + Intergenic
1127374425 15:58370056-58370078 GCAGATATAGGGAACATCAATGG - Intronic
1127438750 15:58985408-58985430 GAAAATAAAGGGATGCGCAATGG - Intronic
1129696213 15:77741936-77741958 GGAGAGAAAGAGATGGGCAAGGG + Intronic
1132920275 16:2385961-2385983 TCAGGGAAAGGGATGGACAAAGG - Intergenic
1134502599 16:14780879-14780901 GCAGATATGGGGAAGGTGAAAGG - Intronic
1134577964 16:15348016-15348038 GCAGATATGGGGAAGGTGAAAGG + Intergenic
1134724624 16:16409530-16409552 GCAGATATGGGGAAGGTGAAAGG - Intergenic
1134942807 16:18302329-18302351 GCAGATATGGGGAAGGTGAAAGG + Intergenic
1138993124 16:62416511-62416533 CCAGAAAAAGGGATGGGCAAAGG - Intergenic
1139605632 16:68016189-68016211 GCAGAGATTGGGATGGACAAAGG + Intronic
1139975182 16:70804348-70804370 GCAGAGAAAGTGATGATCAAAGG + Intergenic
1143261925 17:5605920-5605942 GAAGATAAGGGGATGGAGAAAGG + Intronic
1144036449 17:11370355-11370377 GCAAAGAAGGGGAGGGTCAAGGG - Intronic
1147720865 17:42538482-42538504 GCAGGTAAAAGGATGGAAAAGGG + Exonic
1148492687 17:48033458-48033480 GCAGATAAGGGGAAGGACACGGG - Intronic
1153611943 18:6895015-6895037 GCACATAAAGGAATGGTAGAGGG + Intronic
1156032399 18:32727547-32727569 GCAGATAAGGGGATGTGTAATGG - Intronic
1158038832 18:53068635-53068657 GCAGGTACAGGGATGCTCACTGG - Intronic
1158556822 18:58482246-58482268 GCACATACAGTGATGATCAAAGG + Intronic
1158779303 18:60627415-60627437 AAAGATAGATGGATGGTCAATGG + Intergenic
1158783316 18:60678215-60678237 GAAGATAAAGGGAAGGGAAAAGG + Intergenic
1163064767 19:14784986-14785008 GAAGCTAAAGGGAAGGTCAAGGG - Intergenic
1165194454 19:34090723-34090745 GCAGAGAAATGGATGGTAATTGG + Intergenic
1166422109 19:42645228-42645250 GAGGAAAAAGGGAAGGTCAATGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167471895 19:49680143-49680165 GCAGACACAGGGAAGGGCAAAGG - Intronic
1167600929 19:50454392-50454414 GCAGAAAGAGGGAAGGTCAGAGG - Intronic
1168327604 19:55546225-55546247 CCAGAGAAAGGGAGGGACAAAGG - Intergenic
1168397867 19:56064243-56064265 ACAGCCAAAGGGAAGGTCAAAGG + Intergenic
927333161 2:21890152-21890174 CCAGATAAAAGGAGGGTAAAGGG + Intergenic
928660378 2:33495809-33495831 GCACATAGTGGGATGGTAAATGG + Intronic
929541048 2:42822217-42822239 GAAAATAAAGGGATGGAAAAAGG - Intergenic
932120950 2:69099600-69099622 GAAGAGAAAGAGATGGACAATGG - Intronic
933596619 2:84289238-84289260 GCTGCCAAAGGGATGCTCAAAGG - Intergenic
934979151 2:98826005-98826027 GCTGATAAAGAGATGCTCACAGG - Intronic
936441881 2:112561280-112561302 GCAGAAAAAGAGATGGGGAAGGG + Intronic
939247446 2:139644591-139644613 TCAGACAAAGGGCTGGTCCATGG + Intergenic
939853733 2:147331384-147331406 GCAGGCAAGGGGATGGTCATAGG - Intergenic
940690157 2:156907064-156907086 GAAAATCAAGGGATAGTCAAAGG + Intergenic
941306937 2:163881629-163881651 GCAGTTAAAAGGATGGACAGTGG + Intergenic
944201892 2:197116602-197116624 CCAGAGAAAGGGATGATAAAAGG - Intronic
944454908 2:199883365-199883387 GGATCTAAAGGGCTGGTCAAGGG + Intergenic
944754303 2:202743916-202743938 CCAGAAGAAGAGATGGTCAAAGG + Intronic
945018505 2:205546676-205546698 GCAGATAGAGGGTTGCTAAAGGG - Intronic
945825061 2:214711717-214711739 GCAGAGAAAGGGACAGTCAATGG - Intergenic
945956828 2:216094038-216094060 GGAAATAAAGGGATGGCAAATGG + Intronic
946915888 2:224520886-224520908 GCACATAAAAGTATGCTCAAAGG + Intronic
947356408 2:229300476-229300498 GCAGAGAAAGAGAGGGCCAATGG + Intergenic
948548571 2:238751551-238751573 GAAAATAAAGGGATGGAAAAGGG + Intergenic
948553578 2:238792078-238792100 GAAGACAAAGGGAGGGTCAGTGG + Intergenic
948842188 2:240657368-240657390 GAAGATAAAAGGATGGAGAAAGG - Intergenic
1170897173 20:20425987-20426009 GCAGATAAAGACATGCTCCAGGG - Intronic
1175631930 20:60547860-60547882 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1175818014 20:61893604-61893626 GCAGATAGAGGGATAGTGGATGG + Intronic
1176062615 20:63178924-63178946 GGAGACAAAGGGAGGGTCCACGG + Intergenic
1176866960 21:14059109-14059131 GCAGATTCAGGGAAGGTCCAGGG + Intergenic
1183054183 22:35291999-35292021 GCAGAGAAATGGATGCTCAAAGG + Intronic
1185157469 22:49202833-49202855 GCAGAGAAAGAGATGGTGAAGGG + Intergenic
949190930 3:1248132-1248154 GCACATGAAGGAATGCTCAAAGG - Intronic
949862478 3:8518808-8518830 GCAGAGAAAGGGGTAGTCAGAGG + Intronic
952505046 3:33999664-33999686 GGTGATAATGGGATGGCCAAAGG - Intergenic
953628372 3:44589706-44589728 GGATATAAACTGATGGTCAAAGG - Intronic
954400905 3:50319050-50319072 GCAGGAAAAGGGATGGTCACTGG + Intronic
956428874 3:69164645-69164667 GAAGAAAGAGGGAAGGTCAAAGG - Intergenic
956808797 3:72844346-72844368 GCAGATAAAGGTATTGTCTTTGG - Exonic
957340060 3:78884039-78884061 GCAGATAAAAGGAAAGGCAAAGG + Intronic
957602094 3:82350407-82350429 GCACTTAAAGGGATGCTAAAAGG + Intergenic
958907830 3:99961380-99961402 ATACATAAAGGGATGATCAAAGG - Intronic
959236290 3:103726760-103726782 ACAGAGAAATGCATGGTCAAAGG - Intergenic
959436373 3:106319472-106319494 TAAGATAAAGGGATGGAAAAGGG + Intergenic
961517849 3:127449530-127449552 CCAGAAAAATTGATGGTCAAGGG + Intergenic
963076511 3:141352450-141352472 ACAGATGGAGGGAAGGTCAATGG + Intronic
963271525 3:143290223-143290245 GCATAAAATGGGATGGTCCAAGG + Intronic
965251112 3:166345201-166345223 GAAAATAAAGGGATAGACAAAGG + Intergenic
965737399 3:171836029-171836051 CCAGATAAAGGGATGGAGAGGGG + Intergenic
967566729 3:190981328-190981350 GAAGAAAAAGGGATAGTTAATGG - Intergenic
968292711 3:197551184-197551206 GGAGAAGATGGGATGGTCAATGG - Intronic
970002279 4:11375862-11375884 ACAGATAAAAGGAAGCTCAATGG - Intergenic
970373387 4:15431908-15431930 GCAGATAAAAGGAAGGTCATGGG + Intronic
971229635 4:24790617-24790639 ACAGGTGAAGAGATGGTCAATGG + Intronic
972014778 4:34230204-34230226 GATGATAAAGGGATGGAAAAAGG - Intergenic
972343318 4:38171837-38171859 GCAGACAAAGGGATGGCAAGGGG + Intergenic
973574045 4:52268000-52268022 CCAGCTGAAGTGATGGTCAAAGG - Intergenic
974013467 4:56627825-56627847 GCAGACACAGGGCTGGTCACTGG - Intergenic
976929612 4:90549538-90549560 GCAGATGAAGGGAAGGTTTAGGG + Intronic
977721951 4:100249390-100249412 CCAGATAAAGAGTGGGTCAATGG + Intergenic
978960688 4:114674408-114674430 ACAGATAAAGGGAAGGGAAATGG - Intronic
979816331 4:125110360-125110382 GAATATAAAGGGATGGTAAGAGG - Intergenic
979936513 4:126704297-126704319 GAGGAAAAAGAGATGGTCAAGGG - Intergenic
980089480 4:128427687-128427709 GCATATAAAAGGGTGGTGAAAGG - Intergenic
980204553 4:129700758-129700780 TCAGAGAAAGGGCTAGTCAAAGG + Intergenic
985099007 4:186439217-186439239 GCAGACATAGGGATGGTTAACGG + Intronic
986141832 5:5038309-5038331 TCAGAGAAAAAGATGGTCAATGG + Intergenic
987465392 5:18266007-18266029 GCAGAAAAAGTGCTGATCAAAGG + Intergenic
988347369 5:30055806-30055828 GTAGACAGTGGGATGGTCAATGG + Intergenic
988354891 5:30161209-30161231 GCAAATGAAGGCATGGTCCATGG - Intergenic
988376474 5:30441559-30441581 GAAAATAAAGGGATGGAAAAAGG + Intergenic
989978125 5:50609023-50609045 GCAGATAAACACATGGACAAAGG - Intergenic
990695064 5:58407298-58407320 GAAGACAGAGGGATGGTAAATGG + Intergenic
990962410 5:61408653-61408675 GCAGGTAAAGGAAGGGTTAAGGG + Intronic
991034148 5:62110645-62110667 GCAGCAAAAGTGATGGCCAAGGG + Intergenic
993710726 5:91222006-91222028 GAGGATATAGGGAAGGTCAAGGG + Intergenic
994269949 5:97764926-97764948 GCACATGAAGGGATGCTCAGGGG + Intergenic
995606840 5:113866079-113866101 GCAGAAAATGGGATGGAGAAGGG + Intergenic
996241706 5:121211992-121212014 GGAGATTTAGGGATGGTTAATGG - Intergenic
996773652 5:127110944-127110966 GTAGCCAAAGGCATGGTCAAAGG - Intergenic
997444679 5:133932642-133932664 GCAGATGGCGGCATGGTCAAGGG - Intergenic
998431101 5:142070733-142070755 GCAGAGAATGGAAGGGTCAAGGG - Intergenic
1000156710 5:158559389-158559411 GCAGAGAAAGAGATGGGGAAGGG - Intergenic
1001599963 5:172922465-172922487 GCAGGTAAGGGGATGGGGAATGG + Intronic
1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG + Intergenic
1007138457 6:39546390-39546412 GGAGATAAAGAGATGATTAAGGG - Intronic
1008307214 6:49918165-49918187 GAAGATAAAGGGAAGGGGAAAGG - Intergenic
1008841247 6:55907381-55907403 TATGATAAAGGGATGGTTAATGG - Intergenic
1011238462 6:85244034-85244056 ACAGATAAAGATATGGTCAGTGG + Intergenic
1011755441 6:90494214-90494236 GCAGCTACAGGGAAGGACAATGG + Intergenic
1012777615 6:103517745-103517767 GGAGATAAAGGGATGGATAATGG - Intergenic
1022900679 7:34807588-34807610 GGAAATAGAGGGATGGCCAAAGG - Intronic
1024822130 7:53344198-53344220 ACAGACAAAGGGATGTGCAAAGG - Intergenic
1025018499 7:55462451-55462473 GAAGAAAAAGAGATGGGCAAAGG - Intronic
1026200236 7:68207886-68207908 GCATTTCAAGGGATGGTCCAGGG + Intergenic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1027607549 7:80318768-80318790 GGAGCTGATGGGATGGTCAAGGG - Intergenic
1028963029 7:96771053-96771075 GCTGAGAAAGGGATGTTAAAAGG + Intergenic
1030626238 7:111848909-111848931 GCAGATAAAGGGATGGTCAATGG - Intronic
1030706529 7:112698192-112698214 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1032805976 7:135354677-135354699 GCTGATAAAGGGATTGAAAATGG - Intergenic
1034527775 7:151676456-151676478 GCAAATAATGGGAGGGGCAACGG + Intronic
1034658122 7:152745426-152745448 GCTGAGAAAGAGATGGTGAAAGG + Intergenic
1034760850 7:153670325-153670347 GAAGATAAAAGGGTGGTAAAAGG - Intergenic
1035648245 8:1244932-1244954 GCCGAGAAAGGGATGGGCAGAGG + Intergenic
1037211863 8:16398653-16398675 GCAGATAAAGGGGTTGCCCAGGG - Intronic
1041078875 8:54195563-54195585 ACAGATGAATGGATAGTCAATGG - Intergenic
1042796529 8:72669228-72669250 GCAAATGGAGGGATGATCAAAGG - Intronic
1045879111 8:107016404-107016426 GCAGGTAACAGGAAGGTCAAAGG + Intergenic
1048447346 8:134501706-134501728 GCAGATAAAAGGAGAGTCACTGG - Intronic
1048506317 8:135025507-135025529 GGAAAAAAAGGGATGGGCAATGG - Intergenic
1049364328 8:142229433-142229455 GCAGATGAATGGATGGTGTACGG + Intronic
1051456978 9:17269410-17269432 GCAGAAAAAGGAATGGTAAGAGG - Intronic
1052661474 9:31438486-31438508 GCAGAAACAGTGATGGGCAAGGG - Intergenic
1053467262 9:38317811-38317833 GCTGATAAATGTATGGTCATTGG - Intergenic
1057070494 9:92095185-92095207 GTAGATGAAGTGATGCTCAAAGG + Intronic
1057785381 9:98083514-98083536 TCAGAGAAAGGACTGGTCAAAGG + Intronic
1057877465 9:98768681-98768703 CCACATAAAGGGAGAGTCAAAGG - Intronic
1057951019 9:99369209-99369231 GCAGCTACAGAGATGGCCAAGGG + Intergenic
1057970300 9:99549912-99549934 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1059703211 9:116795765-116795787 GCAGAGAAAGGAATGGTTATTGG + Intronic
1061905882 9:133696818-133696840 GCAGCTAAAGCGATGCTCACAGG + Intronic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1187756833 X:22537372-22537394 TCAGAGAAAGTGATAGTCAAGGG + Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1197115667 X:122829989-122830011 GCAGAGAAAGGGAGAGTAAAGGG + Intergenic
1197351457 X:125388118-125388140 GCAGATAAAGGGATGGTCTCTGG - Intergenic
1198146669 X:133864241-133864263 ACAGATGAAGGGAAGGTTAAAGG + Intronic
1198276552 X:135099394-135099416 GCTGAGAAAGGGAAGGACAACGG - Intergenic
1198286648 X:135197662-135197684 GCAGATTAAGGGAGGTTCAGGGG - Intergenic
1200036097 X:153331941-153331963 GAAGAGAAAGGGATAGTCATGGG + Intergenic
1200533005 Y:4359934-4359956 GCAGAGAAAGGGTTGGGCCATGG + Intergenic
1201054106 Y:9971278-9971300 GAAGGTAAAGGGAGGATCAAAGG + Intergenic