ID: 1030626790

View in Genome Browser
Species Human (GRCh38)
Location 7:111853679-111853701
Sequence TGGGATTAAAGCCAGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030626790_1030626796 -1 Left 1030626790 7:111853679-111853701 CCCACCCACTGGCTTTAATCCCA 0: 1
1: 0
2: 3
3: 15
4: 167
Right 1030626796 7:111853701-111853723 ACCCTGAATGCCTCCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030626790 Original CRISPR TGGGATTAAAGCCAGTGGGT GGG (reversed) Intronic
900120683 1:1047478-1047500 GGGGAGGAAGGCCAGTGGGTAGG - Intronic
903052895 1:20614763-20614785 TGGGATTGAAGTCAGAGGGGTGG + Intronic
904116204 1:28163780-28163802 TGGCAGGAAAGCCAGTGTGTAGG - Intronic
904511364 1:31011657-31011679 TGGTATTTATGCCAGTGGGTTGG - Intronic
906810749 1:48824713-48824735 TGGGATAAAAGCTAATGGCTGGG + Intronic
910484127 1:87693092-87693114 TGGGATTAAAGACATTTTGTGGG - Intergenic
911487092 1:98515872-98515894 TGGGCTTAGAGCCAGTGGATGGG + Intergenic
916542858 1:165773900-165773922 TGGGAGAGAAGACAGTGGGTTGG + Intronic
917733569 1:177900382-177900404 TGGGATTACAGCCACTGGGTTGG - Intergenic
917738414 1:177940582-177940604 TGGGATTGGAGCCAGGGCGTTGG - Intronic
917780109 1:178385764-178385786 TGGGATTGGTGCCAGTGAGTGGG - Intronic
918275941 1:182953504-182953526 TGGGGTTAGAGCCATTGCGTTGG - Intronic
919507438 1:198416952-198416974 TGGGATTGAAGACAGAGGTTTGG - Intergenic
920281798 1:204849114-204849136 TGTGATCAAAGCCAGAGGGTGGG + Intronic
921943654 1:220870913-220870935 TGGGATTATAGACAGTTGTTAGG + Intergenic
923134509 1:231106372-231106394 AGGGTTTTAAGGCAGTGGGTAGG - Intergenic
924815375 1:247437064-247437086 TGGGAATTAAGGCAGTGGCTTGG - Intronic
1064250718 10:13704502-13704524 TAGGATTAAAGCCACGTGGTAGG - Intronic
1067946501 10:50692475-50692497 TGGGATTGAGGCCAGTGGGATGG - Intergenic
1070881814 10:79857476-79857498 TGGGATTGAGGCCAGTGGGATGG - Intergenic
1070932126 10:80268499-80268521 TGGGATGAAAGGCATGGGGTGGG - Intergenic
1071648392 10:87373790-87373812 TGGGGTTGAGGCCAGTGGGATGG - Intergenic
1075452922 10:122565781-122565803 GCGGATTAAAGCAAGTGGATTGG - Intronic
1075594809 10:123721349-123721371 TGGGATGAAAGTCACTGGGAAGG + Intronic
1076830005 10:132989276-132989298 TGGGAAGAAAGACAGTGTGTGGG + Intergenic
1077384579 11:2262956-2262978 TGGGGGCAAGGCCAGTGGGTGGG + Intergenic
1078055980 11:8009293-8009315 TGGGATGACACCCTGTGGGTTGG - Intergenic
1078786793 11:14502299-14502321 TGGAATAAAAGGCAGTGGCTGGG - Intergenic
1082232872 11:49790415-49790437 CGGAAGTACAGCCAGTGGGTAGG + Intergenic
1086617756 11:88843502-88843524 CGGAAGTACAGCCAGTGGGTAGG - Intronic
1088806976 11:113361275-113361297 TGAGATTAAAGCCATTGGGGGGG + Intronic
1088901892 11:114124490-114124512 TGGGATTAAGGCCAGTCATTTGG + Intronic
1088982482 11:114876252-114876274 AGGGATTCAAGCCTGTGTGTTGG - Intergenic
1089762277 11:120736452-120736474 TGGGCTTAGAGCCAGTGGACTGG - Intronic
1090733157 11:129589188-129589210 TGAGATTAAAGTCAGTGTGTTGG - Intergenic
1097768204 12:63549851-63549873 TGGATTTAAAGCCAGCAGGTTGG + Intergenic
1097784564 12:63744914-63744936 TGGATTTAAAGCCAGCAGGTTGG + Intergenic
1099845088 12:88018867-88018889 TGGGGTTACAGGCATTGGGTAGG - Intronic
1100562994 12:95767838-95767860 TGGGAATAGAGCCTGTGGTTTGG + Intronic
1102047829 12:109840861-109840883 TGGAATCACAGCCAGTGGCTGGG - Intergenic
1102377687 12:112436464-112436486 TGGGATTTGAGACAGTGGTTTGG + Intronic
1105263246 13:18795553-18795575 TGGAAAAAAAGCAAGTGGGTAGG - Intergenic
1106779324 13:33041344-33041366 TGTGATTAAAGCTATTAGGTTGG + Intronic
1108004068 13:45930244-45930266 TGGGATCACAGTCTGTGGGTTGG - Intergenic
1109150441 13:58840976-58840998 TGGCATTAAAACCAGTGGATTGG - Intergenic
1110090290 13:71436566-71436588 TGGGAGTCAAGCAATTGGGTAGG - Intergenic
1113511854 13:110862806-110862828 TGTGAATAAAGCCTGAGGGTGGG - Intergenic
1114783814 14:25570680-25570702 TGGGCTTAGAGCCAGTGTCTAGG - Intergenic
1115923346 14:38403018-38403040 TGGTATACAAGCCACTGGGTAGG + Intergenic
1117008381 14:51445339-51445361 TGTCATCAAAGCCAGTGGTTGGG + Intergenic
1117283495 14:54263916-54263938 TGGGATTTCAGCCAGTGAGGAGG + Intergenic
1120157149 14:81106063-81106085 TGTGATTGAAGCCACTGGGAAGG + Intronic
1120965932 14:90167770-90167792 TGGGATTATTGGCAGGGGGTGGG - Intronic
1122040462 14:98984174-98984196 TGGAAGTAAAGTCTGTGGGTGGG - Intergenic
1122859518 14:104576276-104576298 TGGGAGTGAAGCCTGAGGGTGGG - Intronic
1127630167 15:60820621-60820643 TGGGAGTAAAGGCAGAGGGGTGG + Intronic
1130441219 15:83955952-83955974 TGGGGTTAGAGCCAGTGGACTGG - Intronic
1133185039 16:4089938-4089960 TGTAATTCAAGCCTGTGGGTAGG - Intronic
1134347072 16:13401050-13401072 TGGGATCAGAGTCTGTGGGTGGG - Intergenic
1136845304 16:33571952-33571974 TGGAGTTCAAGCCACTGGGTAGG - Intergenic
1139791794 16:69443552-69443574 TAGGCTTAAAACCAGAGGGTCGG + Intronic
1203107012 16_KI270728v1_random:1420605-1420627 TGGAGTTCAAGCCACTGGGTAGG - Intergenic
1203155472 16_KI270728v1_random:1872250-1872272 TGGAGTTCAAGCCACTGGGTAGG - Intergenic
1145069121 17:19788183-19788205 TGGGCTTAAAGCCAGTGGATTGG + Intronic
1145314867 17:21723628-21723650 TGATATCAAAGCCTGTGGGTGGG - Intergenic
1145713308 17:26995565-26995587 TGATATCAAAGCCTGTGGGTGGG - Intergenic
1146437010 17:32859506-32859528 TGGTCCTAAAGCCATTGGGTTGG - Intronic
1147518544 17:41145419-41145441 TGGGATTCAAGCCAGTAAGCAGG + Intergenic
1149568759 17:57657455-57657477 TGGGATTTAGGCCAGTGGGAGGG - Intronic
1150060094 17:62060351-62060373 TGGGATTACAGGCAGGAGGTAGG - Intronic
1150712256 17:67541830-67541852 TGGGACCAAGACCAGTGGGTAGG + Intronic
1150728273 17:67669239-67669261 TGGGATGATAGGCAGTAGGTGGG + Intronic
1152707561 17:81852616-81852638 TGGGTTTGATGCCAGTTGGTGGG - Intronic
1153626425 18:7025828-7025850 TTGGATTAAAGACAGAGGGGTGG - Intronic
1155050820 18:22146381-22146403 TGGGATTTGAGACAGAGGGTGGG + Intergenic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1157074852 18:44454279-44454301 TGGGATCAAAGACAGTGTATCGG - Intergenic
1158123445 18:54076086-54076108 TGGGAAAAAATCCAGTGGGAAGG - Intergenic
1160059460 18:75516153-75516175 TGGAAATAAGGCCAGTGGCTGGG + Intergenic
1160187831 18:76689039-76689061 TGAGAGTGAAGCCTGTGGGTCGG + Intergenic
1160867486 19:1262306-1262328 TTGGCTTAGAGCCACTGGGTTGG + Intronic
1162182957 19:8883139-8883161 GGGGATGAAAGCAAGTGGATGGG + Intronic
1162442511 19:10701690-10701712 TGGGTCTAAGGCCGGTGGGTGGG + Exonic
1165824126 19:38695916-38695938 TGGGTTTAAAGCCAGGTGCTGGG - Intronic
925212080 2:2057944-2057966 TGGGATTAATGCCTGAGAGTGGG + Intronic
929740403 2:44593618-44593640 TGGTATTCAAGACAGTGGGCAGG - Intronic
930684065 2:54288917-54288939 TGAAACTAAAGCCAGTAGGTGGG - Intronic
931070903 2:58648355-58648377 TGTGAATAAAGGCAGTGGGAAGG - Intergenic
931121430 2:59224739-59224761 TGGCATTTAAGGCAGTGGGAAGG + Intergenic
931155254 2:59621540-59621562 TGGGACTATGGCCAGTGGCTTGG - Intergenic
931932560 2:67156270-67156292 TGGGAGTTAAGACAGTGGTTTGG + Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932389368 2:71372172-71372194 TGGGATTAGAGCTAGTGGGCTGG - Intronic
935217339 2:100984766-100984788 TGGGATAAAGGCCACTGGGTGGG - Intronic
936642572 2:114331531-114331553 TGGAATTAAAGCTAGTTTGTGGG + Intergenic
938652910 2:133402106-133402128 TAGGATTTAATCCAGAGGGTTGG + Intronic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
941273290 2:163457807-163457829 TAGGAATGAAGTCAGTGGGTTGG - Intergenic
942193088 2:173490334-173490356 TGGGATTAAAGCCATTGAAATGG + Intergenic
943117573 2:183692170-183692192 TGGGATTAGAGCCAGTGGAATGG - Intergenic
946982912 2:225237714-225237736 TGGGATTAAAGTCAATGGAATGG - Intergenic
947381112 2:229546236-229546258 TGGAATTAAAACCACTGGGATGG - Intronic
1169029906 20:2398851-2398873 AGGTATTAAGGTCAGTGGGTGGG + Intronic
1169442442 20:5643969-5643991 TGGCATTAAAGCCATGGGATTGG - Intergenic
1171057933 20:21926070-21926092 TGGTCTTATAGCTAGTGGGTGGG + Intergenic
1173167408 20:40695228-40695250 TTGTATTTAAGCCAGGGGGTGGG - Intergenic
1173453898 20:43189030-43189052 TCGGAGAAAAGCCAGCGGGTAGG + Intronic
1174974549 20:55316844-55316866 TGAGACTAAAGCCAATGGGAAGG - Intergenic
1175755152 20:61525001-61525023 TGGCATTGAAGCCAGCTGGTGGG - Intronic
1177048417 21:16200929-16200951 TGGAAGGAAAGCCAGTGGTTTGG + Intergenic
1177686647 21:24446188-24446210 TGGGATTCAAGCCAGAAGGATGG - Intergenic
1178109975 21:29360440-29360462 TGGGAATGAGGCCAGAGGGTTGG - Intronic
1179892677 21:44344852-44344874 TGTGGTTTCAGCCAGTGGGTCGG + Intergenic
1180606809 22:17065153-17065175 TGGTATTCCAGCCAGTGGGAAGG - Intergenic
1180785548 22:18545339-18545361 TGGGACTACAGCTAGTAGGTGGG + Intergenic
1181129134 22:20719379-20719401 TGGGACTACAGCTAGTAGGTGGG + Intronic
1181242454 22:21484691-21484713 TGGGACTACAGCTAGTAGGTGGG + Intergenic
1185154011 22:49182521-49182543 GGGGATCAAAGCCAGTGGCAGGG - Intergenic
949452192 3:4198193-4198215 TGGAAATAAAACCAGTGAGTGGG + Intronic
949690925 3:6638162-6638184 GAGGATTAAATTCAGTGGGTAGG + Intergenic
950347234 3:12307613-12307635 TGGGAATAAAGACTGTGTGTAGG + Intronic
952155653 3:30641056-30641078 TGGGATGAGGGCCAGTGGGAGGG - Intronic
953770726 3:45777156-45777178 TGGGATTGAGCCCAGTGGGGTGG - Intronic
954111961 3:48438873-48438895 AGGAATGAGAGCCAGTGGGTAGG - Intronic
954640586 3:52095529-52095551 AGGTGTTAAAGCCAGGGGGTGGG - Intronic
954710710 3:52503918-52503940 TGGGAGCAGAGACAGTGGGTTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
957659285 3:83126290-83126312 TGGCTTTAAAGCCACTGGTTTGG + Intergenic
960580599 3:119275425-119275447 TGGGAGTAAAGCCAGTGATGGGG + Intergenic
961095137 3:124148038-124148060 TGGGATTAATGAAAGTGGGAAGG + Intronic
963479841 3:145858003-145858025 TGAGCTGAAAGCCAGTGGTTTGG + Intergenic
964558092 3:157963143-157963165 TGTGATGAGGGCCAGTGGGTGGG + Intergenic
966660930 3:182413798-182413820 TGGTAGCAATGCCAGTGGGTAGG - Intergenic
970335490 4:15036074-15036096 TGGGATAAAAGCCAGGAAGTTGG + Intronic
971333131 4:25698943-25698965 TGGGATTGGAGTCAGTGAGTAGG + Intergenic
976981989 4:91243376-91243398 TGGGATTAGAGCCAGTGGACTGG + Intronic
978677290 4:111334498-111334520 TGGGATTAAACTCATTGGATTGG - Intergenic
978992218 4:115098389-115098411 GTGGATTAAAGCCAGCAGGTAGG + Intronic
979928664 4:126601695-126601717 TGGTATTAAAGCCATGGGGCTGG + Intergenic
985532515 5:442564-442586 TGGGAACAATGCCAGTGGGATGG - Exonic
985791587 5:1931114-1931136 TGGCATTTCAGCCAGTGGGAGGG + Intergenic
985966679 5:3343151-3343173 TGGCATTAAGGACAGAGGGTTGG - Intergenic
987387227 5:17341702-17341724 TGGGAATAAAGTCAGTATGTTGG + Intergenic
989737352 5:44724561-44724583 TTGTCTTAAAGCCAGTTGGTGGG + Intergenic
992956749 5:81917776-81917798 TGGGTTTAGAGGCAGAGGGTAGG - Intergenic
994343803 5:98662393-98662415 TGGGCTTAGAGACAGTGGATTGG + Intergenic
1001764598 5:174235444-174235466 TGGTAATGAAGCCAGGGGGTGGG + Intronic
1001840916 5:174875962-174875984 TGGGAATGAAGCCAGTGGCTGGG + Intergenic
1002163449 5:177330999-177331021 TGGGATCAGAGCCAGAGGGGTGG + Intergenic
1003003314 6:2357793-2357815 TGGGAGTGATGCCGGTGGGTGGG - Intergenic
1003154867 6:3583911-3583933 TGGGATGAAGGGCAGTGGGAGGG - Intergenic
1005822675 6:29610655-29610677 GGGGATTAGAGGCAGGGGGTGGG - Intronic
1006225871 6:32535584-32535606 AGGGATTGAAGGCTGTGGGTTGG + Intergenic
1006695383 6:35926360-35926382 TGGGAATAAAGGCAGTAGCTAGG + Intergenic
1007320120 6:41022110-41022132 TGTGGTGAAAGCCTGTGGGTGGG + Intergenic
1011784671 6:90830535-90830557 TGTCTTCAAAGCCAGTGGGTGGG + Intergenic
1014942464 6:127459011-127459033 TGGGCTTAAAAACAGTGGGCGGG - Intronic
1018332662 6:162748129-162748151 TGTCATTAAAGAAAGTGGGTTGG + Intronic
1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG + Intronic
1022031938 7:26499730-26499752 TGCAATTAAGGCCAGTGGCTGGG + Intergenic
1024447423 7:49497639-49497661 TGAGATTGAAACCAGTGGGCAGG - Intergenic
1026239691 7:68562162-68562184 TGGGATTCATGCCATTAGGTTGG - Intergenic
1030626790 7:111853679-111853701 TGGGATTAAAGCCAGTGGGTGGG - Intronic
1031862229 7:126993951-126993973 TGGACTTAGAGCCAGTGGATTGG + Intronic
1038889029 8:31697671-31697693 TGGGATTAAAGACATTGCTTAGG - Intronic
1040580922 8:48697907-48697929 TGGGAGGAAAGGCAGTGGTTGGG + Intergenic
1042390460 8:68228202-68228224 TGTGAATAAAGCCAGTGTGCTGG - Intronic
1047661437 8:127041430-127041452 TGGAAATAAAGTCAGTGGGCTGG + Intergenic
1047841114 8:128754422-128754444 TGGGCTTAGAGCCAGTGGACTGG + Intergenic
1055400301 9:75916656-75916678 TGGAAGGAAGGCCAGTGGGTTGG + Intronic
1056204163 9:84304343-84304365 TGGGATTAATGTCTGTGGTTTGG + Intronic
1059451913 9:114376240-114376262 TGGGATGGAGGCCAGTGGGGTGG - Intronic
1062256694 9:135626501-135626523 TGGGCTCAAAGGCAGTGGCTGGG - Intronic
1062312496 9:135946556-135946578 TGGGACTGAAGCCAGTGGAAAGG + Intronic
1186435171 X:9536871-9536893 AGGGATTAAAGCCACTGCCTTGG - Intronic
1187415761 X:19092145-19092167 TGGGATCAAAGGCTGTGGATTGG - Intronic
1189181878 X:39012137-39012159 TGGGATAGCAGCCAATGGGTGGG + Intergenic
1189360581 X:40347541-40347563 TGGGATGAATGCCAGTTGGCCGG - Intergenic
1192005672 X:67209554-67209576 TGGGATGAGAGAAAGTGGGTAGG + Intergenic
1193092475 X:77509885-77509907 TGGGCTGAAAGCCAGTGGACGGG + Intronic
1196312016 X:114179565-114179587 TGAGATAAAAGCAAGTGAGTGGG - Intergenic
1197461972 X:126754114-126754136 TGGGATAAAAGCCTGTGGGAGGG + Intergenic
1198151128 X:133910983-133911005 TTGGATGAAAGACAGTGGGGAGG - Intronic
1199100696 X:143796375-143796397 TGGGATTAACACCAGTGGAAGGG + Intergenic
1199590195 X:149460626-149460648 TGGGAAGAAAGCCACTGGATTGG - Intergenic
1199982374 X:152928131-152928153 TGGAATGAAAACCAGTGGGAGGG - Intronic