ID: 1030627365

View in Genome Browser
Species Human (GRCh38)
Location 7:111858834-111858856
Sequence ATGTGTCTATACATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030627365_1030627372 23 Left 1030627365 7:111858834-111858856 CCTTCCTCCATGTATAGACACAT 0: 1
1: 0
2: 3
3: 50
4: 527
Right 1030627372 7:111858880-111858902 TGGAGAAATCTGACTAATACAGG No data
1030627365_1030627370 3 Left 1030627365 7:111858834-111858856 CCTTCCTCCATGTATAGACACAT 0: 1
1: 0
2: 3
3: 50
4: 527
Right 1030627370 7:111858860-111858882 CCCTATTGGTTCTGTTTCTCTGG 0: 27
1: 376
2: 1019
3: 1768
4: 7763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030627365 Original CRISPR ATGTGTCTATACATGGAGGA AGG (reversed) Intronic
902901478 1:19519412-19519434 CTGTGTCTTTACATGGTTGAAGG + Intergenic
905347244 1:37319428-37319450 ATGTGTATATCCCTGGATGAGGG + Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905393297 1:37651702-37651724 GTGTGTCTGTACATAGGGGAAGG + Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908469773 1:64432397-64432419 ATGTGACTATGCATTCAGGAAGG - Intergenic
910593175 1:88950055-88950077 CTGTGTCCTTACATGGTGGAAGG - Intronic
910924952 1:92388629-92388651 GAGTGACTATACCTGGAGGAGGG + Exonic
911230970 1:95361277-95361299 ATGTGTGTATACATGTGTGAGGG + Intergenic
911240726 1:95462949-95462971 TTGTGTCTTCACATGGTGGAAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
912557502 1:110526884-110526906 TTCTGTCTATACATGGTGGTTGG + Intergenic
912713107 1:111963621-111963643 AAGAGTTTTTACATGGAGGAAGG + Intronic
912903878 1:113682699-113682721 ATCTGTTCATACATGAAGGATGG - Intronic
913148756 1:116018965-116018987 CTGTGTCTATCGATGGATGAAGG - Intronic
913268393 1:117067671-117067693 ATAAGTCTATATATGGATGATGG + Intronic
914017609 1:143834707-143834729 ATGTGTCCTCACATGGTGGAAGG + Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914222918 1:145696412-145696434 ATGTGACTATACTTGGAGACAGG + Intronic
914656219 1:149743239-149743261 ATGTGTCCTCACATGGTGGAAGG + Intergenic
915699499 1:157777615-157777637 ATGTGTCTTCACATGATGGAAGG + Intergenic
915754797 1:158249401-158249423 ATGTGTCCTTACATGGTGGAAGG + Intergenic
917185548 1:172350747-172350769 ATCTGTATATACATGGAGGCAGG + Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917794819 1:178525730-178525752 ATGTGTCTTCACATGGTAGATGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918313033 1:183300084-183300106 ATGTGTCCTCACAAGGAGGAAGG - Intronic
918538912 1:185605873-185605895 CTGTGTCTCTACATGGTAGAAGG - Intergenic
918731118 1:187998136-187998158 ATGTGACTATATTTGGAGGTAGG - Intergenic
919283385 1:195520469-195520491 ATGTGTCTATGCATGTCAGATGG - Intergenic
919461852 1:197885991-197886013 ATGTGTCCTCACATGGTGGAAGG + Intergenic
919537395 1:198805239-198805261 ATGTGACTATATTTGGAGAAAGG + Intergenic
920064045 1:203252758-203252780 CTGTGTCATAACATGGAGGATGG + Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
922916040 1:229258669-229258691 ATGTGTCTGAACAGGAAGGAAGG - Intergenic
923319529 1:232816939-232816961 CTGTGTCCTTACATGGAAGAAGG + Intergenic
923450240 1:234110321-234110343 ATGTGTCAATTGATGGAAGATGG + Intronic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924644632 1:245866393-245866415 AACTTTCTGTACATGGAGGAGGG + Intronic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063031511 10:2239866-2239888 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1063892615 10:10645839-10645861 TTGCTTCTATACATGGAAGAGGG - Intergenic
1064062170 10:12147386-12147408 AATTTTCTATACATGGAGGCTGG + Intronic
1064540200 10:16397431-16397453 ATGTGACTTTACATGGGAGAAGG - Intergenic
1065412893 10:25449792-25449814 ATATCTGTATACATTGAGGAAGG - Intronic
1066338194 10:34501995-34502017 ATATGTCTTTACATGGTGGGAGG - Intronic
1066385626 10:34939048-34939070 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1066425124 10:35301279-35301301 ATGTGTGTAGACATGATGGAAGG + Intronic
1068897545 10:62223914-62223936 AAGTGTCTATCCAGGGATGAAGG + Intronic
1069029108 10:63576933-63576955 ATGTGTCTATATTTGGAGTTAGG - Intronic
1071213503 10:83371704-83371726 GTGTGTGTTTTCATGGAGGAAGG - Intergenic
1071403906 10:85309278-85309300 ATGTGTCTCTATATTGATGATGG + Intergenic
1071497990 10:86181595-86181617 AAGTGTCTATACTTCAAGGAAGG - Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073753380 10:106555280-106555302 ATGTGTATAAATATGGAGGGAGG + Intergenic
1073973243 10:109069264-109069286 TTGTGTCTTTACATGGTAGAAGG + Intergenic
1074509203 10:114097736-114097758 ATGTGACTATATTTGGAGAAGGG + Intergenic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078778138 11:14412189-14412211 AAGTGTCTCTAAATGGGGGAAGG + Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079413584 11:20212256-20212278 ATGTGACTATATTTGGAGAAAGG + Intergenic
1079519691 11:21311990-21312012 ATGTGTCCTTGCATGGTGGAAGG - Intronic
1080103430 11:28486016-28486038 ATGTGTCTATATTTGGAGGCAGG - Intergenic
1080450098 11:32371941-32371963 CTGTGTCCTTACATGGTGGAGGG - Intergenic
1080991365 11:37539871-37539893 CTGTGTCTTCACATGGAGGGAGG - Intergenic
1081174635 11:39912453-39912475 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1083916519 11:65748162-65748184 ATGTGACTATATTTGGAGGCAGG - Intergenic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1085182024 11:74544017-74544039 ATGTGTCCCTGCCTGGAGGATGG + Intronic
1085818207 11:79763924-79763946 ATGTGTCCATACAGGGAGACTGG + Intergenic
1086032476 11:82376780-82376802 ATGTGACTATACTTGGAGACAGG - Intergenic
1086079497 11:82888782-82888804 AGGTGTGTGTATATGGAGGAGGG - Intronic
1087036013 11:93757476-93757498 ATGTGTGCATACATGCATGAAGG + Intronic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087675258 11:101154288-101154310 ATTTGACTATATATGGAGGTAGG + Intergenic
1088568794 11:111201134-111201156 ATGTATCTTCACATGGAGGAAGG + Intergenic
1088713439 11:112528191-112528213 ATGTGTCCTTACCTGGTGGAAGG - Intergenic
1088743832 11:112787984-112788006 ATGTGTCCTCACATGGTGGAAGG - Intergenic
1089132132 11:116220468-116220490 TTGTGTCCTTACATGGTGGAAGG - Intergenic
1090137465 11:124212699-124212721 ATATGTGTATCCATGTAGGAAGG + Intergenic
1090438816 11:126709516-126709538 ATGTGTCTATATTTGGAGATAGG + Intronic
1090470333 11:126975304-126975326 AGCTGTCTTGACATGGAGGATGG - Intronic
1090761928 11:129845291-129845313 GTGTGTGTATGCATGAAGGAAGG + Intronic
1090761933 11:129845361-129845383 GTGTGTGTATGCATGAAGGAAGG + Intronic
1090873569 11:130769246-130769268 ATGTGACTATACTTGGAGACAGG - Intergenic
1090980463 11:131716149-131716171 CTATGTCTTTACATGGTGGAAGG + Intronic
1092361472 12:7840196-7840218 ATGTGTCCTCACATGGTGGAAGG - Intronic
1092824024 12:12380351-12380373 GTGTGCCTATATATGGAAGATGG + Intronic
1093904701 12:24676811-24676833 CTGTGTCCTTACATGGAGAAAGG + Intergenic
1094145875 12:27227843-27227865 AAGTGTCTATACATGAATGTAGG - Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1097644867 12:62224443-62224465 CTGTGTCCTTACATGGTGGAAGG + Intronic
1098140806 12:67448562-67448584 AGGTGTGTATACAAGGTGGAGGG - Intergenic
1098576706 12:72050966-72050988 ATGTGTCAATATATAGAGGTCGG + Intronic
1098660796 12:73091115-73091137 CTGTGTCCTTACATGGCGGAAGG + Intergenic
1098954503 12:76675787-76675809 ATGTGTCTTCACATGGTAGAAGG - Intergenic
1099441716 12:82707226-82707248 CTGTGTCCTTACATGGAGGTCGG + Intronic
1099473741 12:83082769-83082791 ATGTCTCTATAAATTTAGGAAGG - Intronic
1100127718 12:91449836-91449858 ATGGATCTTTGCATGGAGGAAGG - Intergenic
1100155819 12:91799113-91799135 ATGTGTGTATATATAGGGGATGG - Intergenic
1100339653 12:93666233-93666255 CTGTGTCTTTACATGGTAGAGGG - Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100665603 12:96749227-96749249 ATGTGTCCTTACATGGTGGAAGG + Intronic
1100737034 12:97546731-97546753 ATGTGTCTATACATGGGGAGTGG + Intergenic
1100755127 12:97742821-97742843 ATGTGATTATACTTGGAGAAAGG - Intergenic
1101015326 12:100494655-100494677 AAGTGGCTAGACATGGAGGCAGG - Intronic
1101260610 12:103025892-103025914 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102598400 12:114010886-114010908 ATATGACTATATTTGGAGGAAGG - Intergenic
1103012808 12:117470224-117470246 ATGTGTAGATACATGCCGGATGG - Intronic
1104167208 12:126244212-126244234 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1104353651 12:128066534-128066556 ATGTGACTGTACATGGAGGTAGG + Intergenic
1104445122 12:128826480-128826502 ATGTGTCTATACATGTTCAAGGG + Intergenic
1104453007 12:128886601-128886623 ATGGCTCTGGACATGGAGGAAGG - Intronic
1105601142 13:21888384-21888406 ATCTGTCTATAAATGCAGAAAGG + Intergenic
1105939485 13:25134582-25134604 ATGTGTCAACCCATGGTGGAAGG + Intergenic
1106455718 13:29924872-29924894 GTGTGTCTTTCCATGGAGGAAGG + Intergenic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1106708178 13:32303483-32303505 AGTTGTGTATACTTGGAGGAAGG + Intergenic
1106856540 13:33859901-33859923 ATATGACTATACATGGAGATAGG + Intronic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107660650 13:42635939-42635961 ATAAGCCTACACATGGAGGAAGG + Intergenic
1107864007 13:44686062-44686084 CTTTGTCTACTCATGGAGGAAGG + Intergenic
1107999505 13:45893469-45893491 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1108156457 13:47590357-47590379 TTGTATCCTTACATGGAGGAAGG + Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1109031820 13:57199950-57199972 ATGTGACTACTGATGGAGGATGG + Intergenic
1109485856 13:63018178-63018200 AGGTGTCCTTACATGGGGGAAGG + Intergenic
1110124308 13:71923277-71923299 ATGTGTCAATTCATGGGTGAAGG - Intergenic
1110357496 13:74584718-74584740 ATGTGACTATATTTGGAGTAAGG - Intergenic
1110791743 13:79593292-79593314 ATGTGTCTTCACATAGTGGAAGG - Intergenic
1110918804 13:81058450-81058472 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1111240528 13:85467466-85467488 CTGTGTCCTTACGTGGAGGAAGG - Intergenic
1111731693 13:92085005-92085027 GTGTGTCCTTACATGGTGGAAGG + Intronic
1112084434 13:96015446-96015468 ATGTGTCTATAGGTACAGGAAGG - Intronic
1112279064 13:98046809-98046831 ATGTGAGGATACAGGGAGGAAGG - Intergenic
1112698882 13:101981322-101981344 CTGTGTCCTTACATGGCGGAAGG - Intronic
1115965583 14:38884101-38884123 ATGAGTGTGTGCATGGAGGAGGG + Intergenic
1118655128 14:67939213-67939235 ATGTGTTTCCACATGGAGGGGGG - Intronic
1118701466 14:68438005-68438027 ATGTGTCTGTACAATGAGTAGGG + Intronic
1120161389 14:81149059-81149081 ATGTGACTATATTTGGAGGTAGG + Intergenic
1120322620 14:82984365-82984387 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1120861924 14:89262255-89262277 ACTTGTCTATTCATTGAGGATGG + Intronic
1120916222 14:89712950-89712972 ATGTGTCCACACATGGTAGAAGG + Intergenic
1120938648 14:89923641-89923663 ATGTTTCTATACCTGGAAGCAGG + Intronic
1121403362 14:93702348-93702370 CTGTGTTTATAAATGGAGTATGG - Intronic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121963710 14:98285199-98285221 ATGAGTGTAGACTTGGAGGAGGG + Intergenic
1121974732 14:98392374-98392396 CTGTGTCCTTACATGGTGGATGG - Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1123416178 15:20097202-20097224 ATGTGTCCTTACATGGTAGAAGG - Intergenic
1123525518 15:21104307-21104329 ATGTGTCCTTACATGGTAGAAGG - Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124857738 15:33407079-33407101 CTGTGTCTACACGTGGTGGAAGG + Intronic
1125383898 15:39115689-39115711 ATGTGCCTACACATGGAGCTGGG - Intergenic
1125726141 15:41869134-41869156 ATGTCTCATTGCATGGAGGAAGG + Intronic
1125984008 15:44031504-44031526 ATATGTCCTTACATGGTGGAAGG + Intronic
1126568376 15:50124375-50124397 GTGAGTCTTTTCATGGAGGATGG - Intronic
1126952872 15:53901567-53901589 AATTGTCTATAGATAGAGGAGGG - Intergenic
1127362682 15:58258945-58258967 CTGTGTCTTCACATGGCGGAAGG + Intronic
1127921918 15:63501322-63501344 TTGTGTATATACATGGAAGTGGG - Intergenic
1128194200 15:65736129-65736151 ATGTGTCTACATTTGGAAGATGG + Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128643636 15:69359104-69359126 ATGTGTCTTCACATGGTGGAAGG + Intronic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1133563428 16:6970575-6970597 TTGTGTCTTCACATGGTGGAAGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134979756 16:18597714-18597736 ATGTGTGTAGACATGCTGGAAGG + Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135681338 16:24459898-24459920 ATTTGTCTGTACATGGGAGATGG + Intergenic
1137390921 16:48081000-48081022 ATGTGTCCTCACATGGAGGAAGG + Intergenic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1140721450 16:77775902-77775924 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1141417106 16:83884135-83884157 CTGTGTCCCTACATGGTGGAAGG - Intergenic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1144027582 17:11292201-11292223 ATGTGACTATATTTGGAGAAAGG - Intronic
1146309583 17:31756929-31756951 CTGTGTCCCTACATGGTGGAAGG - Intergenic
1146417072 17:32644800-32644822 GTGTGTCTCTACATGTAAGATGG + Intronic
1147625886 17:41899604-41899626 GTCTGTCTGTACAAGGAGGAGGG - Intronic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149682913 17:58518080-58518102 ACGAGACTATACCTGGAGGAAGG + Intergenic
1150310576 17:64125799-64125821 ATGTTTTTTTACATGGATGATGG + Intronic
1150841102 17:68606395-68606417 GTGTGTTCATACATGGAGGTGGG + Intergenic
1151268527 17:72975502-72975524 CTGTGTCCTTACATGGCGGAAGG - Intronic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152918682 17:83054770-83054792 ATGTGTCCTCACGTGGAGGAAGG - Intergenic
1153122335 18:1743914-1743936 CTGTGTCTCTACATGGCAGAAGG - Intergenic
1153792271 18:8589360-8589382 ATGTGACTGTATATGGAGGTTGG - Intergenic
1154053613 18:10988781-10988803 ATATGACTAGACATGGAGGGAGG + Intronic
1154061344 18:11063515-11063537 ATGTGTATATCCATAGAGGTAGG - Intronic
1155758845 18:29538495-29538517 ATATGTCTATACATGTATGTAGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156208674 18:34914144-34914166 ATTTGTGTTTACTTGGAGGAGGG - Intergenic
1156612257 18:38738694-38738716 GTGTGTCAATCCATGGTGGAAGG + Intergenic
1156830023 18:41480695-41480717 AATTGTGTATACATGGAGGTGGG - Intergenic
1156918117 18:42485442-42485464 ATTTATCTCTACATGGAGAAGGG + Intergenic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1157533021 18:48438323-48438345 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1157626966 18:49059191-49059213 CTGTGTCCTTACATGGTGGACGG - Intronic
1157679291 18:49591255-49591277 ATGTGTATATGCATGGGGAAAGG + Exonic
1158162308 18:54499120-54499142 ATGTGTCCTTACATGGTGGAAGG + Intergenic
1158460288 18:57640340-57640362 CTGTGTCTTTACGTGGTGGAAGG - Intergenic
1158625352 18:59066572-59066594 ATGTGTCCTCACATGGCGGAAGG + Intergenic
1158946793 18:62454003-62454025 ATGGGTCTGTACCTAGAGGAGGG - Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159294849 18:66471741-66471763 ATGTCTCTCTACATGGATTAGGG + Intergenic
1162874490 19:13610622-13610644 ATGTTTCTGTCCATGTAGGAGGG - Intronic
1163184944 19:15631153-15631175 ACGTGTCTTTACATGGTGGAAGG - Intronic
1164473309 19:28553922-28553944 TTGTGTCATCACATGGAGGAGGG - Intergenic
1166534866 19:43566581-43566603 AAATGTTTATACATGGAGGCTGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
925160387 2:1679379-1679401 GTGTGTCTATAAATGGTGGGTGG + Intronic
926379872 2:12276203-12276225 CTGTGTCTTTACATGGCAGAAGG - Intergenic
926908396 2:17827134-17827156 CTGTGTCCTTACATGGTGGAAGG + Intergenic
927346639 2:22051641-22051663 ATGTGTCTATACATCTACCAAGG + Intergenic
927431861 2:23033292-23033314 CTGTGTCCTTACATGGGGGAAGG + Intergenic
927447199 2:23173775-23173797 GTGTGTCTCTACATGTAAGATGG - Intergenic
929039849 2:37733815-37733837 ATGTGGCTTTCCGTGGAGGAGGG + Intronic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
930079855 2:47436791-47436813 CTGTGCCTATACAGGGAGGTTGG - Intronic
931062341 2:58545420-58545442 ATCTCTTTATACCTGGAGGAGGG - Intergenic
932290442 2:70572767-70572789 GTGTGTGTATACGTGGGGGAGGG + Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
936600053 2:113887175-113887197 CTGTGTCAAAACATGGTGGAAGG + Intergenic
937362832 2:121240929-121240951 ATGTGTGTGGACATGCAGGAGGG - Intronic
937494180 2:122400505-122400527 CTGTGTCTTCACATGGCGGAAGG - Intergenic
939105777 2:137946875-137946897 ATATGTCTTTGCATGGTGGAAGG - Intergenic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
942973582 2:181987079-181987101 ATGTGTCTATCCATGCTGAATGG + Intronic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
943976605 2:194486726-194486748 CTGTGTCTTTATATGGAAGATGG - Intergenic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
944653087 2:201851450-201851472 CTGTGTCCTTACATGGTGGAAGG + Intronic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
945945444 2:215990649-215990671 ATGTGTCTTTGCATGTAAGATGG - Intronic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
947069349 2:226269463-226269485 ATGTGTTAATAGATGAAGGATGG - Intergenic
947337952 2:229106599-229106621 ATGTGTCCTCACATGGTGGAGGG - Intronic
947997241 2:234538485-234538507 ATTTGTCTTTACTTAGAGGAAGG - Intergenic
1169386827 20:5156978-5157000 ATGTGCCTACACTTGGAGTAGGG + Intronic
1169465503 20:5834864-5834886 TTGTGCCTTTACATGGTGGAAGG + Intronic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170239261 20:14145089-14145111 ATGTATCTATACAAGGGAGAAGG - Intronic
1170391959 20:15884898-15884920 CTGTGTCCATGCATGGAGGAAGG + Intronic
1171815507 20:29782895-29782917 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1172405750 20:34687605-34687627 ATGTGTGTATATTTGGGGGATGG - Intergenic
1173349984 20:42235837-42235859 ATGTGTTTTTACTTGGAGAATGG - Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1175434255 20:58931534-58931556 CTGTATCTGTACATGGTGGAAGG - Intergenic
1175608835 20:60333418-60333440 ATGTGTCCTTGCATGGGGGAAGG + Intergenic
1176136251 20:63523297-63523319 AGCTGTGTGTACATGGAGGAGGG - Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176347066 21:5758203-5758225 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1176353880 21:5878787-5878809 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1176497761 21:7566252-7566274 ATGTGTTTATCCAGAGAGGAGGG - Intergenic
1176541387 21:8156273-8156295 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1176560338 21:8339318-8339340 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1176873917 21:14107171-14107193 ATGTGACTATACTTGGAGATAGG + Intergenic
1177072913 21:16533398-16533420 ATGTGTTTACACATGGAAAAGGG + Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177872506 21:26590496-26590518 TTGTGTCTTCACATGGTGGAAGG - Intergenic
1178066817 21:28913579-28913601 ATGTGTCTATATTTGGAGATGGG + Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178629344 21:34245676-34245698 CTGATTCTATACATGGACGATGG - Intergenic
1178631490 21:34265098-34265120 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1178665534 21:34543205-34543227 ATGTTGCCATACATGGAAGAAGG + Intronic
1180032602 21:45222658-45222680 AAGCATCTATATATGGAGGAGGG + Exonic
1181959004 22:26609601-26609623 ACGTGTGTATAAATGGAGAATGG + Intronic
1182401848 22:30084258-30084280 CTGTGTCATAACATGGAGGAAGG + Intronic
1182597753 22:31435280-31435302 ATATGTGTATATATGGAGGTGGG + Intronic
1203246327 22_KI270733v1_random:72692-72714 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1203292135 22_KI270736v1_random:5386-5408 ATGTGGCTTTCCATGGAGGAGGG + Intergenic
949438261 3:4052190-4052212 ATGTGTCTCCACATGATGGACGG + Intronic
949714723 3:6916596-6916618 ATGTGTCCTCACATGGTGGAAGG + Intronic
949734977 3:7161270-7161292 ATTTGTTTATACTTGGAGCAGGG - Intronic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950931699 3:16795882-16795904 ATGTGACTATATTTGGAGGTAGG - Intergenic
951753177 3:26059862-26059884 CTGTGTCTTTACATGGTGGAAGG + Intergenic
952100959 3:30012288-30012310 ATGTGTCTTTACAAGGCTGAAGG + Intergenic
952809940 3:37392745-37392767 ATGTGTCTGTACATTGTGGAGGG - Intronic
953946820 3:47156480-47156502 ATGTGTCAATAAAAGGAGAATGG + Intronic
955011793 3:55024541-55024563 CTGTGTCTTTACATGATGGAAGG - Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
956298176 3:67737575-67737597 ATGTGTGTATGTTTGGAGGAGGG - Intergenic
956387830 3:68739623-68739645 ATGTGTCCATCAATGGAGGACGG + Intronic
957454520 3:80423652-80423674 CTGTGTCCATACATGGTGAAAGG + Intergenic
959003192 3:100988812-100988834 ATGTATCTTTACATAGAGCAGGG + Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959460935 3:106624517-106624539 CTGTGTCTTTACATGAAGGAAGG + Intergenic
959716504 3:109439261-109439283 CTGTGTCCATACATGGCAGAAGG - Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
960004306 3:112766438-112766460 GTGTGTCCTCACATGGAGGAAGG - Intronic
961703509 3:128765632-128765654 ATGTGTCCTCACATGGTGGAAGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
962948290 3:140194276-140194298 CTGTGTCCTTACATGGTGGAAGG + Intronic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963889148 3:150614389-150614411 ATGTGACTAGAAATGGAGGTGGG + Intronic
963958887 3:151285831-151285853 CTGTGTCCTTACATGGCGGAAGG - Intronic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964858558 3:161173855-161173877 ATGTGACTATATTTGGAGGTAGG - Intronic
966026885 3:175295061-175295083 ATGTGTCAATACATGCAGTCAGG + Intronic
966239728 3:177743114-177743136 GTGTGTCCTTACATGGTGGAAGG + Intergenic
966682465 3:182657335-182657357 CTGTGTCTTTACATGGCAGATGG + Intergenic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
966882570 3:184358601-184358623 ACTCGTCTAGACATGGAGGAAGG - Intronic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967680612 3:192358532-192358554 ATATATATATGCATGGAGGAAGG + Intronic
968180426 3:196591243-196591265 AGGTGACTAAAGATGGAGGAGGG + Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
969597086 4:8155628-8155650 ATGTGACTATGCATGGAGACAGG + Intronic
969687584 4:8684408-8684430 ATGTGACTATATTTGGAGGTAGG + Intergenic
969966843 4:11005289-11005311 TTCTGTCTTTACATGGTGGAAGG + Intergenic
970111708 4:12645038-12645060 CTGTGTCAAAACATGGTGGAAGG + Intergenic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970793130 4:19882606-19882628 ATGTGACTATATATGGAGATAGG - Intergenic
971483119 4:27131857-27131879 ATGTGACTATATTTGGAGGTAGG + Intergenic
971645252 4:29191182-29191204 ATGTGACTATATTTGGAGGGAGG - Intergenic
971853270 4:32010936-32010958 GTGTGTTTTTACATGTAGGAGGG - Intergenic
972148555 4:36060900-36060922 ATGTGACTATATTTGGAGGTAGG - Intronic
972220269 4:36947351-36947373 ATGTGACTATATTTGGAGAAGGG + Intergenic
972425310 4:38927390-38927412 CTGTGTCCTTACATGGTGGAAGG + Intronic
973542067 4:51944835-51944857 ATGTGTCTTCACATGGCAGATGG + Intergenic
973599221 4:52524451-52524473 ATGTGTCTTTTCATGTAAGATGG - Intergenic
974138773 4:57853940-57853962 ATGTGTCTTTTCAAAGAGGATGG - Intergenic
974209404 4:58750074-58750096 GTGTGTCTTTGCAAGGAGGATGG - Intergenic
974302296 4:60083537-60083559 GTGTGTCTTTGCATGGAGGATGG - Intergenic
974469060 4:62295682-62295704 ATGTGACTATATTTGGAGAAAGG - Intergenic
975181189 4:71347483-71347505 TTGTGTCTTTACGTGGTGGAAGG + Intronic
976593674 4:86874369-86874391 CTGTGTCTTTACATGGTGGAAGG - Intergenic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
979613284 4:122712240-122712262 ATATGTGTATAGATAGAGGAAGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980668268 4:135969074-135969096 ATGTGTGTGGACATGGAGTATGG - Intergenic
980744438 4:136997408-136997430 ATGTGTCTTTGCATGTAAGATGG + Intergenic
981305884 4:143246786-143246808 ATGTGACTATATTTGGAGGAGGG - Intergenic
981671060 4:147287476-147287498 ATTTGTCCAGATATGGAGGAGGG + Intergenic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982788741 4:159566055-159566077 ATGTGTGGATAGCTGGAGGATGG - Intergenic
983481928 4:168285713-168285735 ATGTGGATATGCATGGGGGATGG + Intronic
983984766 4:174045174-174045196 ATGTGTCTTCACATGGTGAAAGG + Intergenic
984250743 4:177331697-177331719 ATATGTCTATACATGGTGTCTGG - Intronic
984337478 4:178411175-178411197 TTGTGTCTGCACATGGAAGAAGG - Intergenic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984460660 4:180032544-180032566 CTGTGTCATTCCATGGAGGAAGG + Intergenic
984716213 4:182927860-182927882 CTATGTCTAGAAATGGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985898409 5:2764747-2764769 ATGTGACTGTCCATGGAAGATGG - Intergenic
986201888 5:5586652-5586674 GTGTGTCCTCACATGGAGGAAGG + Intergenic
987070221 5:14329434-14329456 ATGTGTCCTCACATGGAGGAAGG - Intronic
987084139 5:14453528-14453550 AAGTGTTTATAAATGTAGGATGG - Intronic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
989428607 5:41325929-41325951 TTGTGTCTTCACATGGTGGAAGG + Intronic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
991025013 5:62019753-62019775 ATGTGTCTTCACATTGCGGAAGG - Intergenic
991053579 5:62298323-62298345 ATCAGACTACACATGGAGGAAGG + Intergenic
992355265 5:75975410-75975432 ATGTCTATAGACATGGAGCAAGG - Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993446763 5:88022628-88022650 TTGTGTCTTCACATGGTGGAAGG + Intergenic
993855067 5:93064170-93064192 ATGTGTCTTTAGAAGGAGAAAGG - Intergenic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
994114269 5:96044372-96044394 CTGTGTCTTTATATGGTGGAAGG - Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995825352 5:116291015-116291037 CTGAGTCTATACATTGAAGAAGG + Intronic
995999932 5:118348175-118348197 ATGTGAGTATACATAAAGGAAGG - Intergenic
996063158 5:119053693-119053715 ATGTGTCTTTACATGGTGGAAGG - Intronic
996183190 5:120445831-120445853 CTGTGTCTTTACATGGTGGAAGG - Intergenic
996776211 5:127135465-127135487 GTGTGTTTATATATGGGGGAGGG - Intergenic
997354773 5:133255205-133255227 ATGTGTCTACACACTGAGGCTGG + Intronic
997421591 5:133772616-133772638 CTGTGTCATTCCATGGAGGAAGG + Intergenic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1000252449 5:159508481-159508503 CTCTGTCTATAAATAGAGGAGGG + Intergenic
1000671911 5:164073493-164073515 GTGTGTCTATGTATGGAGGTTGG + Intergenic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1003875767 6:10434909-10434931 ATGTGACTATATTTGGAGCAGGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004212401 6:13662606-13662628 ATGTGTCCTTACATGGCAGAAGG - Intronic
1004624467 6:17361870-17361892 ATGTGTGTATTTACGGAGGAAGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005560076 6:27030700-27030722 ATGTGACTATACTTGGAGATAGG - Intergenic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1005957808 6:30676847-30676869 ATGTGCCTATAAATGGAGTGGGG + Exonic
1007063628 6:38966918-38966940 TTGTGTCTTCACATGGTGGAAGG + Intronic
1008178138 6:48293485-48293507 ATGTGTGAATACCAGGAGGAAGG + Intergenic
1009324032 6:62328070-62328092 ATGTGACTATATTTGGAGAACGG - Intergenic
1010482993 6:76377355-76377377 ATGTGTCTTTGCATGTATGATGG + Intergenic
1010974450 6:82296748-82296770 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1011555588 6:88568883-88568905 CTGTGTCCTTACAAGGAGGAAGG - Intergenic
1013584824 6:111569080-111569102 ATGTGTCTTTACATGAAAAATGG + Intronic
1014318350 6:119894590-119894612 ATGTGACTATATTTGGAGGTAGG - Intergenic
1014638481 6:123879280-123879302 ATGTGTCTATTTATGTAGTATGG + Intronic
1015175721 6:130305997-130306019 ATGTGTCCTCACATGGTGGAAGG + Intronic
1015369792 6:132437749-132437771 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1017289508 6:152719666-152719688 ATGTGACAATATATGGTGGAAGG + Intronic
1017338220 6:153287139-153287161 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1018605694 6:165595777-165595799 ATGTGTCTGCACATGGCTGAAGG + Intronic
1019229656 6:170548722-170548744 CTGTGTCTTAACATGGTGGAAGG - Intronic
1021797969 7:24276869-24276891 ATGTGTCTCTGCATGTGGGATGG + Intergenic
1021845791 7:24761428-24761450 ATGTGTCCACACCTGGTGGAAGG + Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1024657479 7:51463924-51463946 ATGTGTCTTCACATGGTGGAAGG + Intergenic
1026491369 7:70866686-70866708 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1026533465 7:71220610-71220632 ATGTGTCTGTACTTGGAGATAGG + Intronic
1027462569 7:78473499-78473521 ATGTGGATTTACTTGGAGGAAGG - Intronic
1027575361 7:79923624-79923646 ATGTGAGTATTCATGGAAGAAGG - Intergenic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1028226454 7:88257612-88257634 ACATGTCTAAACCTGGAGGATGG + Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1028892269 7:96001676-96001698 TTGTGTCTTCACATGGTGGATGG + Intronic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029178630 7:98683470-98683492 CTGTGTCCTTACATGGAGGAGGG - Intergenic
1029961950 7:104697035-104697057 TTGTGTCCTTACATGGTGGAAGG + Intronic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1030662362 7:112234396-112234418 CTGTGTCTTTACATGGCAGAAGG + Intronic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1031193277 7:118582486-118582508 ATGTGTTTTTACATGGAAGAGGG + Intergenic
1031275052 7:119711308-119711330 GTGTGTGTGTACATGTAGGAAGG - Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1032761887 7:134951063-134951085 CTGTGTCCTTACATGGTGGAAGG + Intronic
1032932078 7:136684492-136684514 CTGTGTCCTTACATGGAAGAAGG + Intergenic
1032951764 7:136922535-136922557 ATGTGTGTAGACATAGAGTATGG - Intronic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1035599256 8:887259-887281 ATGTGTCTTTGCATGTAAGATGG + Intergenic
1035922614 8:3694186-3694208 ATGTGTCCATAGATGGGGCAGGG + Intronic
1037211430 8:16393034-16393056 AAGTATCTAAACATGGAAGAAGG - Intronic
1037433969 8:18843499-18843521 AAGTATCTTTCCATGGAGGAGGG - Intronic
1037579770 8:20237501-20237523 ATGTGTGTATACATGGGGGTAGG - Intergenic
1037579775 8:20237581-20237603 GTGTGTGTATACATGGGGGTAGG - Intergenic
1037579788 8:20237786-20237808 ATGTGTGTATACATGGGGGTAGG - Intergenic
1038730147 8:30119628-30119650 ATGTGACTATATTTGGAGAAAGG - Intronic
1038773657 8:30508154-30508176 GTATGTATATACACGGAGGAAGG + Intronic
1039607993 8:38898715-38898737 ATGTGTCTCTGAATGGGGGATGG - Intergenic
1039636892 8:39177383-39177405 ATGTGTCTTTGCATGGGAGATGG + Intronic
1039647615 8:39304779-39304801 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1039825171 8:41167153-41167175 ATGTGGCTGTACATGGAGATAGG + Intergenic
1039858596 8:41437307-41437329 ATGTTCATATTCATGGAGGAAGG - Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040893599 8:52342161-52342183 ATATGTGTATACATTGTGGAAGG - Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1041630334 8:60080825-60080847 ATGTGTCTTTGCATGTAAGATGG + Intergenic
1041766982 8:61429099-61429121 ATGTGTCATTCCATGGTGGAAGG + Intronic
1041874193 8:62668862-62668884 ATCTGTCTATAAATTCAGGATGG + Intronic
1041963883 8:63651405-63651427 ATGAGGTTTTACATGGAGGAGGG + Intergenic
1042628635 8:70790916-70790938 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1042866248 8:73358930-73358952 CTGTGTCCTTACGTGGAGGAAGG - Intergenic
1042998848 8:74732732-74732754 ATGTGACTATCAAGGGAGGAGGG + Intronic
1043011645 8:74888499-74888521 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1043034559 8:75179426-75179448 ATGTGCCTATGCATGGAGCTGGG - Intergenic
1043138561 8:76558602-76558624 ATGTGTCTTCACATGGCAGAGGG - Intergenic
1043197512 8:77316298-77316320 ATGTGACTATATTTGGAGAAAGG + Intergenic
1043379800 8:79690353-79690375 ATGTGTCCTTCCATGGTGGAAGG + Intergenic
1043585207 8:81760680-81760702 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1045794038 8:106021682-106021704 ATGTGACAGTACATGGAGGTAGG + Intergenic
1046734227 8:117759155-117759177 ATAAGTGGATACATGGAGGAAGG + Intergenic
1047846407 8:128810347-128810369 CTATGTCCTTACATGGAGGAAGG - Intergenic
1048383004 8:133884668-133884690 ATGTTTCTCTTCTTGGAGGATGG - Intergenic
1048445052 8:134487120-134487142 ATGTGTGTATACATGTACGCAGG + Intronic
1048715062 8:137259306-137259328 ATGAGGCTATAAATTGAGGATGG + Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1050598433 9:7227067-7227089 ATGTGTCAATGCCTGGAGGTGGG + Intergenic
1050605400 9:7295967-7295989 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1052603084 9:30663479-30663501 ATGTGTAAATACATGGAAGCAGG + Intergenic
1052902398 9:33804570-33804592 ATGTGTCTTGACATGGATGTGGG + Intergenic
1055118552 9:72632127-72632149 AAGCTTCTATTCATGGAGGAAGG + Intronic
1055254168 9:74346302-74346324 ATGTGTGTATATATGTATGATGG - Intergenic
1055254169 9:74346336-74346358 ATGTGTGTATATATGTATGATGG - Intergenic
1056244988 9:84686025-84686047 ATGTGTATATATATGGGGGTGGG - Intronic
1056598444 9:88026850-88026872 AGGTGACTATATTTGGAGGAGGG - Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056851021 9:90084306-90084328 ATGTGTCAAATAATGGAGGAAGG + Intergenic
1057113668 9:92500086-92500108 ATTTATTTATACATGGAGGTAGG + Intronic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1059577973 9:115512240-115512262 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1203462661 Un_GL000220v1:55764-55786 ATGTGTTTATCCAGAGAGGAGGG + Intergenic
1185839076 X:3371815-3371837 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185956329 X:4495073-4495095 ATGTGGCTGTTCATGGAGGCAGG - Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186249702 X:7652513-7652535 CTGGGTCCTTACATGGAGGAAGG - Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186750449 X:12616265-12616287 CTGTGTCTTTACATGGGAGAAGG - Intronic
1186845736 X:13529210-13529232 GTGTGTCTTTACATAGAAGAAGG + Intergenic
1188050471 X:25479085-25479107 ATGTGACTACATTTGGAGGAAGG - Intergenic
1188078848 X:25811656-25811678 ATATGTGTACACATGGAGTATGG - Intergenic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1189170002 X:38900076-38900098 ATGTGTCCTTACATGGTGAACGG - Intergenic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1190239355 X:48645394-48645416 ATGTGTGTATGCATGGTGCATGG - Intergenic
1191028666 X:55943450-55943472 ATGAGTCTATTCATGGCGGGAGG + Intergenic
1192792992 X:74401887-74401909 GTGTGACTATATTTGGAGGAAGG + Intergenic
1193272232 X:79543196-79543218 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1194038236 X:88907462-88907484 ATGTGTCTATAAACGTGGGATGG + Intergenic
1194655719 X:96570906-96570928 ATTTGTCTATACCTGGAGATGGG - Intergenic
1194827747 X:98583437-98583459 ATGTGTCTCCACATGGCGGAAGG - Intergenic
1194994542 X:100577341-100577363 TTGTGTCCCTACATGGTGGAAGG + Intergenic
1195042066 X:101023753-101023775 ATGTGTCTATACTTTGAGACAGG + Intronic
1195805667 X:108762769-108762791 TTGTGTCTTTACATGGCAGAAGG + Intergenic
1195834925 X:109103211-109103233 ATGTGTCTATAAATGTTGTATGG + Intergenic
1196255382 X:113511989-113512011 ATGCATCTTTACATGGTGGAAGG - Intergenic
1196974854 X:121148130-121148152 ATGTGTCCTCACATGGAAGAAGG - Intergenic
1197037711 X:121897028-121897050 CTGTGTCTTTACATGGTGGAAGG - Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197788425 X:130224228-130224250 CTGTGTCTTCACATGGGGGAAGG - Intronic
1197908662 X:131455623-131455645 CTGTGTCTTTACATGGCAGAAGG - Intergenic
1198282196 X:135153415-135153437 ATGTGATCATATATGGAGGAGGG - Intergenic
1198288763 X:135219107-135219129 ATGTGATCATATATGGAGGAGGG + Intergenic
1198442579 X:136677541-136677563 AAATGTGTATACATGGAGCATGG + Intronic
1199009416 X:142741124-142741146 ATGTGTCTGTATTTGGAGGTAGG - Intergenic
1199116544 X:143999474-143999496 ATGTGTCTTCGCATGGTGGAAGG + Intergenic
1199817649 X:151412929-151412951 ATGTGACTATATATGGAGATAGG - Intergenic
1199893256 X:152109293-152109315 ATGTGTTTCTTCATGGAGGCAGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1201251519 Y:12063224-12063246 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1201480304 Y:14431704-14431726 CTGTGTCCATACATGGTGAAAGG + Intergenic
1201683016 Y:16669931-16669953 ATGTGACTTTACATGGCAGAAGG + Intergenic
1201788538 Y:17811110-17811132 TTGTGTCTTGCCATGGAGGAAGG - Intergenic
1201813015 Y:18094878-18094900 TTGTGTCTTGCCATGGAGGAAGG + Intergenic
1201919363 Y:19217841-19217863 ATGTGTCTATATATGTGAGATGG + Intergenic