ID: 1030628070

View in Genome Browser
Species Human (GRCh38)
Location 7:111865580-111865602
Sequence CAGGAACACCACCAGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030628070 Original CRISPR CAGGAACACCACCAGGGAAC AGG (reversed) Intronic
900964609 1:5949207-5949229 CAGGAACTACACCAAGGAAACGG + Intronic
903474074 1:23607400-23607422 CAGAAACCAAACCAGGGAACAGG - Intronic
903803734 1:25989394-25989416 CAGGAACATAACCAAGCAACTGG + Intronic
904559784 1:31388697-31388719 CAGGCATCCCACCAGGGCACAGG + Intergenic
905009906 1:34740268-34740290 CAGGGAGACCAGCAGCGAACGGG - Intronic
906296963 1:44654844-44654866 CAGGACGACCACCAGGGCAAAGG + Exonic
906791050 1:48659110-48659132 CAGGAATTCCACCAGGTCACTGG - Intronic
908766052 1:67555515-67555537 ATGGACCAGCACCAGGGAACAGG + Intergenic
912520394 1:110240860-110240882 CAGCCACAGTACCAGGGAACAGG + Intronic
915061878 1:153192895-153192917 TAGCACCACCACCTGGGAACTGG + Intergenic
917515256 1:175701764-175701786 GAGGAGCAGCACCAGGGAGCTGG + Intronic
920232666 1:204480878-204480900 GAGGAACACCACGATGGCACAGG - Intronic
920250076 1:204617609-204617631 GAGGAACATCTCCAAGGAACAGG - Exonic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
920827858 1:209438529-209438551 CAGTAACATCACCTGGGAGCTGG - Intergenic
921818398 1:219589541-219589563 CAGGTACACCCCCAGGGAGCTGG - Intergenic
921838280 1:219800949-219800971 CATGACCACCACCAAGGAGCTGG - Intronic
922671508 1:227511473-227511495 AAGTAACCCCTCCAGGGAACAGG - Intergenic
922926341 1:229350055-229350077 CAGAAACACAAGCAGAGAACTGG + Intergenic
1063133175 10:3195731-3195753 CCCAAACACCACCAGGGAATAGG - Intergenic
1065619844 10:27569696-27569718 TAGGAAGACCAACAGGGAAAGGG - Intergenic
1065644301 10:27818526-27818548 CAGAAACACCTACAGGTAACTGG - Intronic
1067786396 10:49252552-49252574 CAGAATCACAACCAGGAAACGGG + Intergenic
1068192252 10:53667270-53667292 CAGGCACACCTCCAGGCATCTGG + Intergenic
1069464202 10:68623678-68623700 CAGCAACACCACCAGGCAACGGG + Intronic
1070581885 10:77726965-77726987 CAAGAACAGCACCAAGGAAATGG + Intergenic
1070755926 10:78993252-78993274 CAGTAGCAGCACCTGGGAACTGG + Intergenic
1070790936 10:79188939-79188961 CAGGAGCACCTCCTGGGACCTGG + Intronic
1070947469 10:80405249-80405271 CAGGATCACCTCAAGGCAACTGG + Intergenic
1072655584 10:97328022-97328044 TAGCAACAGCACCAGGGTACTGG + Intergenic
1072935100 10:99704535-99704557 CAGTAGCACCACCAGGATACAGG - Exonic
1073601297 10:104848490-104848512 CAGGAATTCCACCAAGGAATTGG - Intronic
1073860241 10:107730707-107730729 AAGGAACCCCACCAGGCTACTGG - Intergenic
1074550199 10:114435706-114435728 ATGGAACTCCATCAGGGAACAGG - Intronic
1077809910 11:5626650-5626672 CAGGAAGATCACCAGAGATCAGG + Exonic
1079545726 11:21629837-21629859 CAGGAACAGCAAGATGGAACAGG + Intergenic
1079937872 11:26640421-26640443 AAGGAACACCACAAATGAACTGG - Intronic
1081553588 11:44136855-44136877 CAGGAAGAACTCCAGGGATCAGG - Intronic
1083167690 11:60901176-60901198 CAGGAACAGCGCCAGGAACCTGG + Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084737106 11:71112611-71112633 TAGGAACAGCACCAGGGGCCAGG + Intronic
1086399234 11:86447199-86447221 CAGCAACACCTACAGGGAAAAGG + Exonic
1087223113 11:95567812-95567834 CTGGATCACCTCCAGGGAAAGGG + Intergenic
1087693623 11:101350382-101350404 CAGGAACACCAGCAGGGCTGGGG + Intergenic
1091122686 11:133069702-133069724 CAGAAACACGCCCAGGAAACGGG - Intronic
1091551416 12:1537925-1537947 CAGAAACACCACAAGGGCAGGGG + Intronic
1091797926 12:3307837-3307859 GAGGGTCACCACCAGGGATCAGG + Intergenic
1092684626 12:11028163-11028185 CATGACCACCACCAAGGGACTGG + Intronic
1092689318 12:11089240-11089262 CATGACCACCACCAAGGGACTGG + Intronic
1092692670 12:11131065-11131087 CATGACCACCACCAAGGGACTGG + Intronic
1092883823 12:12908632-12908654 CAGAATCACCAACAGGGAAAGGG - Exonic
1093014497 12:14142788-14142810 CAGGACCACCACCTGGTGACAGG + Intergenic
1094097845 12:26727995-26728017 CAGGAAAACCACCACTGAAGCGG + Intronic
1095099181 12:38163253-38163275 CTGCAGCACCACCAGGCAACAGG - Intergenic
1096263141 12:50105183-50105205 CAGGAACCCCAGCTGGGAAGGGG - Intronic
1096263424 12:50106560-50106582 CTGGGACACCCCCAGGGAAGGGG + Intronic
1097848417 12:64389288-64389310 CAGGAACAGCACCCGAAAACCGG + Intronic
1098070393 12:66668469-66668491 CAGAAACAGCACCAGGCAGCTGG - Intronic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1100227529 12:92574121-92574143 CAGGAAGACCAACAGGTACCCGG - Intergenic
1101211982 12:102543849-102543871 CAGGAACACATGCAGAGAACAGG - Intergenic
1101417365 12:104520012-104520034 CTGGGACTCCATCAGGGAACGGG + Intronic
1101645198 12:106624991-106625013 CAGTATCAGCACCAGGGACCTGG + Intronic
1103027986 12:117589447-117589469 CAGAAATACCACAAAGGAACTGG + Intronic
1103152945 12:118657274-118657296 CAGAAACACAACCATGGAAGTGG + Intergenic
1105468331 13:20668195-20668217 CAGCAATCCCACCAGGCAACAGG - Intronic
1105821115 13:24081900-24081922 GAGCACCAGCACCAGGGAACAGG - Intronic
1106457835 13:29943105-29943127 CATGAAGACCTACAGGGAACTGG + Intergenic
1107055755 13:36101672-36101694 CAGCAAGGCCACCAGGGAGCAGG - Intronic
1107411258 13:40160707-40160729 TAGGAACACAGCCAGGGAGCAGG + Intergenic
1108447267 13:50522041-50522063 CAGTAACAGCCCCAGGGGACTGG + Intronic
1109435869 13:62301357-62301379 CAGTATTACCACCAAGGAACTGG - Intergenic
1112779060 13:102878102-102878124 CAAGAAGTACACCAGGGAACTGG - Intergenic
1115848472 14:37565761-37565783 GAGGAACACCACAAGGGGGCAGG - Intergenic
1118573009 14:67212995-67213017 CAGCAGCATCACCTGGGAACTGG + Intronic
1119021229 14:71117639-71117661 CAAGAACATCAGCAGGTAACTGG - Intergenic
1120078879 14:80191890-80191912 CAGGAACACCATCATTCAACTGG + Intergenic
1120530569 14:85626030-85626052 CAGGAACACCTCCAGCAAAAGGG - Exonic
1120829303 14:88984009-88984031 CAGTAACACCAACAGAGACCAGG - Intergenic
1121488929 14:94343983-94344005 CTGAGACTCCACCAGGGAACAGG - Intergenic
1122834872 14:104425663-104425685 CAGGGACACGACCTGGGAAGGGG + Intergenic
1124516661 15:30372181-30372203 CAGGAACACCAGCAGGGCGAGGG + Exonic
1124726258 15:32158550-32158572 CAGGAACACCAGCAGGGCGAGGG - Exonic
1128286608 15:66442255-66442277 CCAGAACCCCACCAAGGAACCGG - Intronic
1129154073 15:73706849-73706871 CAGGGACACCACCAGTTAAGGGG + Intronic
1129739870 15:77985015-77985037 CAGGCTCACCAGCAGGGAATGGG - Intronic
1131503696 15:92996954-92996976 CAGGAAAAGGACCAGGGAAAAGG + Exonic
1133454117 16:5928184-5928206 CAGGAACACCACTTGGGCCCAGG - Intergenic
1134026523 16:10958236-10958258 CAGGGACTCCCCCAGGGCACAGG - Intronic
1134820936 16:17246896-17246918 CATGTACCCCAGCAGGGAACAGG + Intronic
1137713894 16:50585931-50585953 AAGGAACACCAACAGTGGACAGG - Intronic
1137852094 16:51756030-51756052 CAGGAACCCCAGAAGGCAACAGG + Intergenic
1138072763 16:54009621-54009643 CTGGAACACACCCTGGGAACCGG - Intronic
1138171558 16:54854823-54854845 CAGGTACTGCACCAGGGAAGAGG + Intergenic
1138453576 16:57107799-57107821 CAGGAACACAATGAGGGAGCAGG - Intronic
1138999531 16:62492642-62492664 CGGGTACACCACCAGGACACAGG + Intergenic
1139249107 16:65477689-65477711 CATGAAAACCACCAGGGGACTGG + Intergenic
1141274192 16:82570238-82570260 CAGGAATACCCCCATGGATCAGG - Intergenic
1141692901 16:85606626-85606648 CAGGCCCACCACCAGGGTGCAGG + Intergenic
1141927243 16:87177791-87177813 AGGGAAGACCACCAGGGAAGTGG + Intronic
1142161225 16:88558669-88558691 GACTCACACCACCAGGGAACGGG - Intergenic
1146605023 17:34250734-34250756 CAGTATCATCACCTGGGAACCGG + Intergenic
1146652259 17:34614016-34614038 CAGGATGACCACGAGGGAAGGGG - Intronic
1148590710 17:48814733-48814755 CTGCAACACCTCCAGGGAAGAGG - Intronic
1149232924 17:54555611-54555633 CAGGATCAGCAGCAGGGAAGAGG - Intergenic
1149557411 17:57584042-57584064 CATCCACACCACCAGGGAGCTGG - Intronic
1149829088 17:59855450-59855472 CAGGAATTCCAAAAGGGAACAGG + Intergenic
1150321630 17:64218949-64218971 CAGAAATACCTCCAGGGACCTGG + Intronic
1151644742 17:75422750-75422772 CAGGCACACCACCAGGCACTAGG + Intergenic
1153026358 18:676386-676408 CTCGAACAGCACCAAGGAACGGG - Intronic
1154434818 18:14335355-14335377 CAGGAACACCCTCAGTGCACTGG + Intergenic
1156353626 18:36322472-36322494 CAGGTACACCAGTAGGGAGCTGG + Intronic
1158174631 18:54640913-54640935 CATGGACATCATCAGGGAACAGG - Intergenic
1160431158 18:78813484-78813506 AAGAAACACCACCAGGCAAGTGG - Intergenic
1161045177 19:2130748-2130770 CAGGAAGGCCACAAGGGAAGAGG - Intronic
1164477466 19:28586497-28586519 CAGGGACAACCCCTGGGAACAGG - Intergenic
1164615740 19:29665841-29665863 CGGAAACACCACCAGCGACCGGG - Intronic
1167431039 19:49454517-49454539 CAGGAACCCCACGAGGGTTCTGG - Intronic
925070673 2:964939-964961 CAGGACCAGAACCAGGGCACAGG - Intronic
926177412 2:10607280-10607302 AAGGAACACCACCGAGGAGCAGG + Exonic
927146432 2:20169316-20169338 CAGGCACTCCTCCAGGGAAGGGG - Intergenic
928343091 2:30462505-30462527 CAGGAAGACCATGAGTGAACTGG + Intronic
928429186 2:31203848-31203870 CAGGAACACAGCTAGTGAACAGG - Intronic
929597907 2:43187588-43187610 CAGGGACACCTCCAGGGAGGAGG + Intergenic
931373082 2:61682340-61682362 CAGGAACACCACTAGAGCCCAGG + Intergenic
934163690 2:89275341-89275363 CAGGCCCACCACCACTGAACCGG + Intergenic
934203582 2:89907183-89907205 CAGGCCCACCACCACTGAACCGG - Intergenic
934986756 2:98893096-98893118 CAGGCACAGCAGCAGGGAGCGGG + Intronic
937136743 2:119559925-119559947 CAGGAACACCACCTGGTCCCTGG + Exonic
937884241 2:126889272-126889294 CAGGAGGACCACCCAGGAACTGG + Intergenic
939612337 2:144326771-144326793 TAAGGACACCTCCAGGGAACTGG + Intronic
940031828 2:149271908-149271930 AAGGAACAGCAGCAGGGAAGGGG - Intergenic
940190605 2:151036675-151036697 CAGGAACACCACCTGTAAAATGG - Intronic
940400679 2:153244733-153244755 TAGGATCACCACCAGGCACCTGG - Intergenic
940413120 2:153389361-153389383 CAGGAGTACCAGCAGGGAAGTGG + Intergenic
941008245 2:160269645-160269667 CTTGAACACCTCCAGGGACCAGG - Intronic
942412480 2:175725358-175725380 CAGGAAAACCACAGGGGAAAGGG + Intergenic
946578023 2:221097574-221097596 CAGGAAAACCACCCTGGAAAGGG + Intergenic
948093142 2:235312558-235312580 AAGGCAGACCACCAGGAAACAGG + Intergenic
949042122 2:241854286-241854308 TGGGAACACCACCAGGAAGCTGG - Intronic
1168966482 20:1901591-1901613 CAGGAACACCAGCAGTTAACAGG - Intronic
1170353551 20:15468386-15468408 CAGGAACAACACCAGGATATTGG - Intronic
1170884035 20:20322643-20322665 CTGGAAGACCACCATGGGACTGG - Intronic
1175397409 20:58675805-58675827 CAGGAACACGGACCGGGAACAGG + Intronic
1176282873 20:64324869-64324891 CAGGAACAATACCAGGGAGGGGG + Intergenic
1176377275 21:6092838-6092860 CAGGAAGGCCACCAAGGAGCAGG - Intergenic
1177333982 21:19700008-19700030 CAAGAACACCACAGGGGAAACGG + Intergenic
1177586230 21:23100064-23100086 CAGGAAGACCCCCAAGGAAAAGG - Intergenic
1178319674 21:31595914-31595936 CAGGAACACAAGCAGGGAGAGGG - Intergenic
1179053155 21:37906575-37906597 CAGCAGCATCACCAGGGAGCTGG - Intronic
1179134293 21:38666384-38666406 CAGGGAGACCACCATGGCACTGG + Intergenic
1179746200 21:43445406-43445428 CAGGAAGGCCACCAAGGAGCAGG + Intergenic
1181639065 22:24187415-24187437 CAGGAACAGCTCCTGGGGACTGG - Exonic
1182257355 22:29048801-29048823 TAGGAACACCCCCATGGTACTGG - Intronic
1183085805 22:35486285-35486307 CAGGAAGAAAACCAGGGGACTGG - Intergenic
1184988645 22:48153093-48153115 CAGGGAGGCCACCAGGGGACGGG + Intergenic
1185042193 22:48510747-48510769 CAGGAACAACATCAAGGAAGAGG + Intronic
1185051843 22:48558077-48558099 CAGCACAACCTCCAGGGAACAGG + Intronic
950771430 3:15314594-15314616 GATGAAGACCACCAGGGAGCTGG + Intronic
951279081 3:20725359-20725381 CAGTGACATCACCTGGGAACAGG + Intergenic
953056443 3:39391297-39391319 AAGGAACACCAATAGGGAAGTGG - Intronic
953075928 3:39570377-39570399 GAGGATTTCCACCAGGGAACAGG - Intergenic
953167983 3:40482311-40482333 CAAGATCAGCTCCAGGGAACTGG - Exonic
953962042 3:47273789-47273811 CAGGAATTCCACCATGGAAGAGG + Intronic
954916044 3:54149404-54149426 CAGGAGGACCACCTGGGAAAGGG + Intronic
956621181 3:71222720-71222742 GAGGAACACCAACAGCGAATGGG - Intronic
959187435 3:103063432-103063454 CAACAACACCATCAGTGAACAGG + Intergenic
959322961 3:104902873-104902895 CAGGCAGGCCAGCAGGGAACTGG - Intergenic
961416192 3:126759123-126759145 CAAGAACACCACAAATGAACAGG - Intronic
961516886 3:127443630-127443652 CAGGCACACCAGCAGGGAGAGGG + Intergenic
964693794 3:159484103-159484125 CAGAGACACCACATGGGAACAGG + Intronic
966029612 3:175329076-175329098 TAGTAACACCTCCAGGTAACTGG + Intronic
967984045 3:195082338-195082360 CAGGAAGACCACCAGGGAGGGGG - Intronic
968115136 3:196083514-196083536 AAGGAACACCACAGGGGAGCAGG - Intergenic
968748022 4:2370966-2370988 CACGAAGACCCCCAGGGAAGAGG + Intronic
970545682 4:17127833-17127855 CAGCAACAGCACCTGGGAGCTGG + Intergenic
970803841 4:20006811-20006833 CAGGCCCACCACCAGAGAGCTGG + Intergenic
972657302 4:41076742-41076764 CAGGAACTTCAGGAGGGAACAGG + Intronic
975318060 4:72978085-72978107 CTGGAACACCACCAGGAAAGAGG + Intergenic
978206840 4:106089999-106090021 CAGAGTCCCCACCAGGGAACCGG - Intronic
978293602 4:107176109-107176131 CAGGATCATGTCCAGGGAACAGG + Intronic
983572555 4:169225410-169225432 GAGGATCACCACCAGAGAAAAGG + Intronic
985101623 4:186463838-186463860 CAGGAAGACCACCAGAGACCAGG + Intronic
985539795 5:482626-482648 CAGAAGCACCACCAGGGCAAAGG + Exonic
991391043 5:66144122-66144144 CAGCAACAGCCCCAGGGACCCGG + Intronic
991497794 5:67244581-67244603 CAGGATCACCAGGAAGGAACAGG + Intergenic
992554667 5:77891723-77891745 CAGGAACAGCACAGGGGAGCTGG + Intergenic
996396164 5:123016322-123016344 CAGGAAAAGCAACAGGGAAGGGG + Intronic
997596137 5:135108536-135108558 TGAGAACACCACCAGGGAAGAGG - Intronic
998505930 5:142672730-142672752 CAGGAAGACCACCTGAGATCAGG - Intronic
999691070 5:154146242-154146264 CACGAACACCAGCAGGTAATGGG + Intronic
1008346960 6:50439492-50439514 CAAGAACACCACAAAAGAACTGG + Intergenic
1009567280 6:65325055-65325077 CAGGTACACCCCCAGGCAGCTGG + Intronic
1010190998 6:73196385-73196407 CAGAAACACCACCAGGAAGTTGG + Exonic
1011669678 6:89671045-89671067 CAGGCGCACCAGCAAGGAACAGG + Exonic
1013265452 6:108493075-108493097 CAGGAACAGCACAAGTGAGCTGG - Intronic
1017343515 6:153353798-153353820 AAAGAACCCCACCAGGAAACTGG + Intergenic
1018334866 6:162776377-162776399 CTGGAAAACAACCAGGGAGCAGG - Intronic
1019016730 6:168885431-168885453 CAGGAGGACCACCAGGGGCCAGG - Intergenic
1019479455 7:1259925-1259947 CAGGACCACCACGAGGGAGGAGG - Intergenic
1019632191 7:2055416-2055438 CAGGAGCGCCACCAGGGAACCGG + Intronic
1020898655 7:13974942-13974964 CAGGGACACTAGCAGGGATCAGG + Intronic
1021972488 7:25979692-25979714 CATGAAATCCACCAGGGAAAGGG - Intergenic
1022575524 7:31493341-31493363 CAGGAACTTGACCAGTGAACTGG - Intergenic
1023625321 7:42109543-42109565 CAGAAAAACCAGCAGGGCACTGG + Intronic
1024238698 7:47417030-47417052 TGAGAACACCCCCAGGGAACAGG - Intronic
1024338590 7:48234667-48234689 CAGCAATACCAACAGTGAACTGG - Intronic
1025224045 7:57141368-57141390 CAGTTACATCACCAGGGAGCTGG + Intergenic
1025722022 7:64025719-64025741 CAGTTACATCACCAGGGAGCTGG - Intergenic
1026498413 7:70922685-70922707 CAGGGACACCCTCTGGGAACAGG - Intergenic
1027503891 7:78990568-78990590 CAGAAAAACCTCCAGGGAAAAGG - Intronic
1029151691 7:98484770-98484792 CAGGCAGACCACCAGGGGAGGGG - Intergenic
1030628070 7:111865580-111865602 CAGGAACACCACCAGGGAACAGG - Intronic
1031838031 7:126702706-126702728 CAAGAACACCACCACAGAACTGG - Intronic
1031949328 7:127875734-127875756 CAGGATGTCCACCATGGAACAGG - Intronic
1032195490 7:129786098-129786120 CAGGAAAGCCTCCAGAGAACTGG - Intergenic
1032736850 7:134700621-134700643 AAGGAACATGATCAGGGAACTGG - Intergenic
1035769961 8:2139097-2139119 CAGCACCACCACCAGAGACCGGG + Intronic
1037184120 8:16041077-16041099 AGGGAACAGCACCAGGAAACAGG + Intergenic
1037730411 8:21519126-21519148 CAGAAGCCCCACCAGGGTACCGG - Intergenic
1037926466 8:22847460-22847482 CAGGAAGACCCCCAAGGGACAGG + Intronic
1039296579 8:36162685-36162707 GTGGAGCACCACCAGGAAACTGG + Intergenic
1040112380 8:43572211-43572233 CAAGAAGTCCCCCAGGGAACGGG - Intergenic
1041794049 8:61727759-61727781 CAGGAAGATCACCAGAGATCAGG - Intergenic
1042403711 8:68378640-68378662 CAGGAACATCACCAAGGACTTGG - Intronic
1045760544 8:105601372-105601394 AGGGAACAAGACCAGGGAACAGG - Intronic
1048543158 8:135361466-135361488 CAGGAAAAGCACCAGGGAATTGG + Intergenic
1049257788 8:141623146-141623168 CAGGAGCGCCAGCTGGGAACTGG - Intergenic
1049408767 8:142463266-142463288 CAGGAGCACCAGCTGGGCACAGG + Intronic
1049562196 8:143317437-143317459 GAGGAACACCACCAGGCCATGGG + Intronic
1049688330 8:143948146-143948168 CAAGCAGACCACCAGGGCACAGG + Intronic
1049826177 8:144670305-144670327 CAGGATCAGCACCTGGGACCAGG + Intergenic
1050128306 9:2382635-2382657 CAGGAAAAGCACCATGTAACGGG - Intergenic
1050246885 9:3699692-3699714 TAAGAACTACACCAGGGAACTGG - Intergenic
1051963788 9:22801152-22801174 CAGGAACCCTCCCAGGGATCTGG + Intergenic
1059249632 9:112877108-112877130 CAGCAGCATCACCTGGGAACCGG - Intronic
1059401964 9:114076307-114076329 CAGGGACCCAACCTGGGAACTGG - Intronic
1059898222 9:118892343-118892365 GAGGAAAGCCTCCAGGGAACTGG + Intergenic
1060241164 9:121904572-121904594 AAGGAACACCACCAGGGCAAAGG - Intronic
1061197342 9:129113958-129113980 AAGGACCACAACCAGGGACCTGG - Intronic
1061260907 9:129480647-129480669 CAGGGAGCCCACCGGGGAACAGG + Intergenic
1061877775 9:133553562-133553584 AAGGTTCACCACTAGGGAACTGG - Intronic
1186370130 X:8937946-8937968 CAGGAACACCTCCAAGGAATAGG + Intergenic
1187833657 X:23408778-23408800 CAGGAATACCAGCAGGGGAGAGG + Intergenic
1189245120 X:39557484-39557506 CAGGAACCCCAGCAGGGCAAGGG + Intergenic
1190237923 X:48631665-48631687 CAGCAGCAGCAGCAGGGAACAGG - Intergenic
1190505066 X:51119215-51119237 CAGCAACCCCACCAGGGAGGTGG - Intergenic
1192952296 X:76029654-76029676 CAGGCCCACTTCCAGGGAACTGG - Intergenic
1194899791 X:99496647-99496669 CAAGAACAGCAATAGGGAACTGG + Intergenic
1197613130 X:128660887-128660909 CAGTAACTCCACTAGGGAAAAGG - Intergenic
1199439131 X:147848572-147848594 CAGGAACAGCAGCAGAAAACTGG + Intergenic