ID: 1030629843

View in Genome Browser
Species Human (GRCh38)
Location 7:111883711-111883733
Sequence CAGGAAAAGGTGATGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030629834_1030629843 25 Left 1030629834 7:111883663-111883685 CCTTAGTGTGTATCTATGAATAG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030629843 Original CRISPR CAGGAAAAGGTGATGTGGTC AGG Intronic
No off target data available for this crispr