ID: 1030640045

View in Genome Browser
Species Human (GRCh38)
Location 7:111994491-111994513
Sequence GCCTAGTCGTGAACTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030640045_1030640050 25 Left 1030640045 7:111994491-111994513 CCAGTACCAGTTCACGACTAGGC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1030640050 7:111994539-111994561 AAGCCTTCATCTGTAACATGAGG 0: 1
1: 0
2: 4
3: 56
4: 569
1030640045_1030640047 -2 Left 1030640045 7:111994491-111994513 CCAGTACCAGTTCACGACTAGGC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1030640047 7:111994512-111994534 GCAGCAACTCATTTAACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030640045 Original CRISPR GCCTAGTCGTGAACTGGTAC TGG (reversed) Intronic
1075284085 10:121167836-121167858 GCCCAGCCTTGAACCGGTACTGG + Intergenic
1076048435 10:127313319-127313341 GCCTACTCGTGAGCTTGTCCTGG - Intronic
1083757621 11:64800198-64800220 GCTGAGTCGTGAACGGGTGCTGG + Exonic
1093541662 12:20294476-20294498 CCCTAGTCAAGAAATGGTACTGG - Intergenic
1100553634 12:95671334-95671356 CCCTGGCCGTGGACTGGTACTGG + Intronic
1118501349 14:66365293-66365315 GCCTAGTCCTCAACTGGTTCAGG + Intergenic
1160364727 18:78314235-78314257 GCCCAGTCGTTACCTGGCACAGG + Intergenic
937858381 2:126689258-126689280 GCCAAGTCCTGACCTGATACCGG + Intronic
947391443 2:229643460-229643482 GCCCAGTCTTGAACTGGGAGAGG + Intronic
1170537973 20:17360522-17360544 GCCCAGTATTGATCTGGTACAGG - Exonic
953768181 3:45759971-45759993 GCCGAGCTGTGAGCTGGTACTGG - Exonic
956049258 3:65230075-65230097 GCTTAGGAGTGATCTGGTACAGG - Intergenic
964875746 3:161366732-161366754 GCCTAGAAGTGACCTGGTACAGG + Intronic
974309569 4:60187581-60187603 TCCTAGTGTTGAACTGGTTCCGG + Intergenic
981088269 4:140706067-140706089 GCCTAGCTGGGAGCTGGTACAGG + Intronic
993546437 5:89218566-89218588 GCCAAGTCATTAACTGGTACAGG + Intergenic
1004127755 6:12889994-12890016 CCCGGGTCGTGGACTGGTACTGG + Intronic
1011528716 6:88296414-88296436 CCCTTGTTGTGCACTGGTACTGG - Intergenic
1014147207 6:118011746-118011768 CCCAAGCCATGAACTGGTACTGG - Intronic
1014936413 6:127390270-127390292 TTCTATTTGTGAACTGGTACAGG + Intergenic
1019196653 6:170287140-170287162 GCCTTGGCCTGAACTGGTTCTGG - Intronic
1030640045 7:111994491-111994513 GCCTAGTCGTGAACTGGTACTGG - Intronic
1031892947 7:127316152-127316174 CCCTAGTCGATAAATGGTACTGG + Intergenic
1037323849 8:17669436-17669458 GCCTAGACGTGAATTTGGACTGG + Intronic
1044251193 8:90005776-90005798 GCCCAGTCTTGAACTTGTCCAGG - Intronic
1049401906 8:142431762-142431784 GCCCAGCCGTGAGCTGGGACTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1192198135 X:69046051-69046073 TCCTAGGAGTGAACTGATACAGG - Intergenic
1195336046 X:103855638-103855660 GCATAGTCGAGTACTGGTAAGGG + Intergenic
1198649104 X:138841202-138841224 GCCTAGGCATGACCTGGTATGGG - Intronic
1201951597 Y:19571185-19571207 GCCTTGTCTTGAAGTGGTATTGG + Intergenic