ID: 1030640154

View in Genome Browser
Species Human (GRCh38)
Location 7:111995789-111995811
Sequence TTTAGCAGCACTGCGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030640154 Original CRISPR TTTAGCAGCACTGCGAAATG AGG (reversed) Intronic
903850013 1:26300451-26300473 TTTAGCAGGTCTGAGAAAAGGGG - Intronic
909096782 1:71297248-71297270 TCCAGCAGCAGTGCCAAATGTGG + Intergenic
910058609 1:83061845-83061867 CTTAGAAGCCCTGGGAAATGGGG - Intergenic
916103331 1:161411711-161411733 TTTAGCATCACTGCAACATAAGG + Intergenic
920763911 1:208812623-208812645 TTTGTCACAACTGCGAAATGGGG - Intergenic
924359480 1:243221979-243222001 TTTAGCATCACTGCCCAAAGAGG + Intronic
924916944 1:248579782-248579804 ATAAGCAGCACTGGGAAAAGTGG + Intergenic
1064612983 10:17123151-17123173 TGTAGCACCACTGTGAACTGAGG - Intronic
1068157588 10:53222105-53222127 CTCCACAGCACTGCGAAATGTGG + Intergenic
1068730701 10:60354912-60354934 TTTAGCAGAAATACCAAATGTGG - Intronic
1071470884 10:85983438-85983460 TTGTGCAGCACTGTGAACTGGGG - Intronic
1081699321 11:45142844-45142866 TTCAGCAGCTCTTCCAAATGTGG + Intronic
1084147327 11:67272062-67272084 TTTAGCATCACTGTCACATGAGG + Intronic
1085359734 11:75876474-75876496 TTTAGCAGCCCTGCTAAATAGGG - Intronic
1087496096 11:98892223-98892245 TTTAGTAGGACTTCGAAATGAGG + Intergenic
1088916464 11:114231592-114231614 TCAAGCAGCACTGTGAGATGGGG - Intronic
1089259633 11:117215096-117215118 TTTAGCAGCACTTCTCAATATGG + Intronic
1091154026 11:133357086-133357108 TCTAGGAGCACTGCGAGAAGTGG - Intronic
1097037353 12:56132607-56132629 TTGAGCAGCTCTGTGAAATGGGG + Intronic
1098897486 12:76080788-76080810 TGTGGCAGCACTGAGAGATGGGG + Intronic
1109916760 13:68998361-68998383 TTTAGCAGCATTGATAAATTAGG + Intergenic
1110036795 13:70697691-70697713 TTTAGGGGCTCTGAGAAATGTGG + Intergenic
1113253264 13:108477854-108477876 TTTAGCAGTGCTACAAAATGTGG - Intergenic
1115744741 14:36424913-36424935 TTTGGCAGCAATGCTAAAAGTGG + Intergenic
1118737884 14:68715306-68715328 TCTAGCCTCACTGCCAAATGAGG + Intronic
1124181857 15:27483568-27483590 TTCAGTTGCACTGGGAAATGAGG + Intronic
1127301920 15:57663215-57663237 TTTAGCAGCACAGCCAGAGGTGG - Intronic
1127378731 15:58409345-58409367 TTTAGCAATACTGAGAAAAGTGG + Intronic
1129463349 15:75710838-75710860 TTTAGGAGGACTCGGAAATGAGG - Intronic
1129721538 15:77880564-77880586 TTTAGGAGGACTCGGAAATGAGG + Intergenic
1132007522 15:98242539-98242561 TGTAGCAGTACTGAGAGATGGGG - Intergenic
1134529758 16:14974383-14974405 TAGATCGGCACTGCGAAATGGGG + Intergenic
1138608501 16:58104543-58104565 TTTACCTGCACTGCCCAATGTGG + Intergenic
1139497503 16:67331214-67331236 TGTAACAGCACTGCGAGGTGGGG - Intronic
1139866590 16:70066579-70066601 TAGATCGGCACTGCGAAATGGGG - Intergenic
1145964113 17:28904660-28904682 TTTAGCTGCACTGCGGATTCGGG + Intergenic
1148839715 17:50487317-50487339 TCTAGTACCACTGCCAAATGAGG + Intergenic
1151026393 17:70682599-70682621 CTTAGCAGCACTGCGCACTGGGG - Intergenic
1153879610 18:9409359-9409381 TTTAACAGCACATCCAAATGTGG + Intergenic
1157236563 18:45970150-45970172 TTTAGCAGCCCTGGGAACTCAGG - Intergenic
1166205578 19:41266602-41266624 TCTAGTAGGACTGGGAAATGGGG + Intronic
926938824 2:18114298-18114320 TTTATCAGCAGTGTGAAAAGTGG + Intronic
926998371 2:18764666-18764688 TTGAGCAACACTGGGAAAAGGGG - Intergenic
927179755 2:20436601-20436623 TTTAGCAAATCTGCAAAATGAGG + Intergenic
928253662 2:29703506-29703528 TTCAGCAGTTCTGGGAAATGAGG - Intronic
931982645 2:67710969-67710991 TTCAGCAGCTTTGAGAAATGAGG + Intergenic
933520196 2:83362027-83362049 TTTAGCAGTTCCGCAAAATGCGG - Intergenic
936396290 2:112134354-112134376 TTTAGAACCACAGAGAAATGTGG + Intergenic
937398157 2:121557084-121557106 GTGAGCAGCACTGCAAAATAGGG - Intronic
937703447 2:124890706-124890728 ATTAGAAGCTCTACGAAATGGGG - Intronic
938531578 2:132192839-132192861 ATTAGCAGCACTGGGAACAGTGG + Intronic
947274719 2:228377477-228377499 TTCTCCAGCACTGAGAAATGGGG - Intergenic
1170346516 20:15392942-15392964 CTTAGCAGCACCGAGAACTGGGG - Intronic
950633059 3:14296901-14296923 TTTAGCACCACTGTCAAATCTGG - Intergenic
954096100 3:48329887-48329909 TTTAGCAGAGCTGAGAAATCTGG + Intergenic
955434274 3:58884610-58884632 TTTAGCAGCTGTGTGACATGTGG + Exonic
959127033 3:102302241-102302263 TAAAGCAGCACTAGGAAATGTGG + Intronic
963428863 3:145169943-145169965 TTTAGCTGTACTGCATAATGTGG - Intergenic
965961927 3:174439855-174439877 TTTGGCAGTTCTGCAAAATGAGG - Intronic
967425910 3:189327258-189327280 TTTAGAAACAATGCAAAATGAGG + Intergenic
968676060 4:1880711-1880733 ATTGGCAACACTGAGAAATGTGG + Intronic
969265649 4:6062579-6062601 GTTGGCAGCACTGTGAGATGTGG - Intronic
977223605 4:94368627-94368649 TTAAGCAGCACTTGGAAATGTGG + Intergenic
978545361 4:109866678-109866700 TTTAGCAGCACTGTCACCTGTGG - Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
984983511 4:185305052-185305074 TGTATCAGCACTGCTAAGTGGGG + Intronic
986871334 5:12050106-12050128 TTTAGCATCACTGCAGAATTAGG - Intergenic
993276400 5:85865280-85865302 TTTAACAGCACTGAGAAATCTGG - Intergenic
993687823 5:90961594-90961616 TTAAGGAGCACTGAGAATTGAGG + Intronic
997689549 5:135817096-135817118 TATAGCAGCAGTGCTCAATGGGG + Intergenic
998201287 5:140125014-140125036 TATACCAGGACTGGGAAATGGGG - Exonic
999137277 5:149330490-149330512 TTTTGCAGCATTGTGAACTGTGG - Intronic
1000810425 5:165854682-165854704 TTTTGAAGTACTGAGAAATGTGG - Intergenic
1006396763 6:33792548-33792570 TTTAGCATTACTGCGCTATGTGG - Intergenic
1008180941 6:48328326-48328348 CTTAACAGCACTGTGACATGGGG - Intergenic
1014281996 6:119451770-119451792 TTTAGCATCACTGTGAGAAGTGG - Intergenic
1015344373 6:132138560-132138582 TTTAGCAGTAGTGGGCAATGTGG - Intergenic
1017621795 6:156306851-156306873 TTTACCAGTTCTGTGAAATGAGG - Intergenic
1019009660 6:168833849-168833871 TTTAACATCACTACGTAATGTGG - Intergenic
1020393531 7:7686687-7686709 TTTAGCTTCACTGTGATATGGGG + Intronic
1022730045 7:33013772-33013794 CTGAGCAGCACTGCGACATTAGG - Intergenic
1025231207 7:57204327-57204349 TTATGCAGCACTGTGAGATGCGG + Intergenic
1025789739 7:64678260-64678282 TTTAGCAGTACTGAATAATGAGG + Intronic
1026449268 7:70513060-70513082 TTTAACAGATCTGCGTAATGGGG + Intronic
1028034746 7:85967358-85967380 TTTGTCAGCAGTGGGAAATGAGG - Intergenic
1030640154 7:111995789-111995811 TTTAGCAGCACTGCGAAATGAGG - Intronic
1037266264 8:17064320-17064342 TTTAGAAGAACTGAGTAATGTGG + Intronic
1042675606 8:71318530-71318552 TTTGGCAGCACTGAGGTATGGGG + Intronic
1043176415 8:77027758-77027780 TTTAGCAACAGTGCCAAATCTGG - Intergenic
1044944418 8:97377403-97377425 TCTAGCATCACTGGCAAATGCGG + Intergenic
1045401326 8:101821787-101821809 TGTAGCAGCACTACAAATTGGGG + Intronic
1047820341 8:128512727-128512749 TTTACCAGGACTGGCAAATGAGG - Intergenic
1050758591 9:9038378-9038400 TTTAGAAGTACAGCGAAGTGGGG - Intronic
1055732015 9:79288112-79288134 TTAGGCAGGACTGCGAAAGGGGG - Intergenic
1056882496 9:90410450-90410472 TTTAGCTGCACTCCAAAATAAGG - Intergenic
1057070524 9:92095426-92095448 CTTTGCAGCAGTGGGAAATGGGG + Intronic
1188515485 X:30981072-30981094 TTATGCAGCACTGGGACATGTGG + Intergenic
1188922346 X:35992515-35992537 TTTAGCAAAACTGAAAAATGAGG + Intergenic
1189136522 X:38556228-38556250 TGTAGCAGTATTGAGAAATGTGG - Intronic
1192848725 X:74931301-74931323 TTTGGCAGCACTGAGCAAGGTGG + Intergenic
1194038680 X:88913690-88913712 TTTAGCTGCACTTTGAAAGGTGG + Intergenic
1194793863 X:98185415-98185437 TTTAGCAGAAATGCTAAACGTGG - Intergenic
1196011182 X:110889571-110889593 TGTAGCAGCTCTGTGAAATCTGG - Intergenic
1197419106 X:126215879-126215901 TTTAGGAGGACTGTTAAATGTGG + Intergenic
1197892253 X:131279161-131279183 TTTTGCAGGACTGTGCAATGGGG - Exonic