ID: 1030640715

View in Genome Browser
Species Human (GRCh38)
Location 7:112003135-112003157
Sequence CTCTGGAAGGTCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030640711_1030640715 -8 Left 1030640711 7:112003120-112003142 CCTGTAATCTGAGCACTCTGGAA 0: 1
1: 63
2: 2117
3: 41020
4: 356440
Right 1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030640715 Original CRISPR CTCTGGAAGGTCAAGGTGGA AGG Intronic
No off target data available for this crispr