ID: 1030641385

View in Genome Browser
Species Human (GRCh38)
Location 7:112010461-112010483
Sequence TGTGACACACATAGCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 2, 2: 23, 3: 24, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030641385_1030641390 12 Left 1030641385 7:112010461-112010483 CCCAGGTGGCTATGTGTGTCACA 0: 1
1: 2
2: 23
3: 24
4: 151
Right 1030641390 7:112010496-112010518 GGAGATGAAGTGGTATCTCCTGG No data
1030641385_1030641389 2 Left 1030641385 7:112010461-112010483 CCCAGGTGGCTATGTGTGTCACA 0: 1
1: 2
2: 23
3: 24
4: 151
Right 1030641389 7:112010486-112010508 AGGACTACGTGGAGATGAAGTGG 0: 1
1: 0
2: 2
3: 8
4: 136
1030641385_1030641388 -9 Left 1030641385 7:112010461-112010483 CCCAGGTGGCTATGTGTGTCACA 0: 1
1: 2
2: 23
3: 24
4: 151
Right 1030641388 7:112010475-112010497 TGTGTCACAGTAGGACTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 85
1030641385_1030641391 26 Left 1030641385 7:112010461-112010483 CCCAGGTGGCTATGTGTGTCACA 0: 1
1: 2
2: 23
3: 24
4: 151
Right 1030641391 7:112010510-112010532 ATCTCCTGGATACTGCTCTATGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030641385 Original CRISPR TGTGACACACATAGCCACCT GGG (reversed) Intronic
900009944 1:96989-97011 TGGGACACACAGAGCAGCCTAGG - Intergenic
900026056 1:273573-273595 TGGGACACACAGAGCAGCCTAGG - Intergenic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
902376525 1:16032545-16032567 TGTGACACACGCAGCCCCCGGGG + Intronic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
904358622 1:29958337-29958359 TGGGACCCACACAGACACCTTGG + Intergenic
905439501 1:37985770-37985792 CCTCACACACATAGCCCCCTTGG - Intronic
911592337 1:99762596-99762618 TGTGACACAGATTTCCAACTGGG + Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
918466328 1:184824903-184824925 ATTGACACACATAGCTACCTTGG + Intronic
921698323 1:218238106-218238128 TGTGGCACACATATACACCATGG + Intergenic
921839291 1:219811380-219811402 GGTGACACACCAAGCCACCCTGG + Intronic
922015067 1:221637044-221637066 TGTAACACACAAAGCCACTGTGG - Intergenic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
924040776 1:239981739-239981761 TGTGTCACAGATGTCCACCTTGG - Intergenic
924286477 1:242493199-242493221 TGTCATACACATAGGGACCTTGG + Intronic
1063429333 10:5976146-5976168 TGTGACACTGCTAGCCAACTGGG + Intronic
1065450778 10:25854475-25854497 AGTGACACACATACCCACAGAGG + Intergenic
1065678100 10:28199491-28199513 TGTGACAGATTCAGCCACCTTGG - Intronic
1067032847 10:42890500-42890522 TGTGACACCTTGAGCCACCTTGG + Intergenic
1069923265 10:71830516-71830538 TGTGTCATACACAGCCTCCTAGG - Intronic
1071491034 10:86136498-86136520 GGTCACACAAATAGCCACTTAGG - Intronic
1074992498 10:118722533-118722555 TGTCAGACACTTAGCCATCTCGG + Intronic
1075018256 10:118927115-118927137 TTTTACAAACATAGACACCTGGG - Intergenic
1076414180 10:130273489-130273511 TGTGACACCGCCAGCCACCTGGG + Intergenic
1078693898 11:13610120-13610142 TTTGAGACACATGGCCACCTTGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1083414083 11:62514001-62514023 TGGGACACATCTAGCCACGTGGG + Intronic
1083773916 11:64883913-64883935 TGTGTCACACTCAGCCACCAGGG + Intronic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1085308520 11:75501892-75501914 TGTGATACACATACCTACCCTGG - Intronic
1086550984 11:88051390-88051412 GGTGACATACATCACCACCTAGG + Intergenic
1088529027 11:110788067-110788089 TGGAACCCCCATAGCCACCTTGG + Intergenic
1089649823 11:119905513-119905535 GGTGACCCACACAGCCTCCTTGG - Intergenic
1093767778 12:22984573-22984595 TGTGACACTCATAGCCTGCCTGG + Intergenic
1094492724 12:30971016-30971038 TCTCACACACAGAGCCAGCTGGG + Intronic
1095600722 12:44010172-44010194 TGTGACACTGACACCCACCTGGG + Intronic
1095682674 12:44997104-44997126 TGTGGCACACATATACACCACGG - Intergenic
1096623968 12:52881914-52881936 TCTGCCAATCATAGCCACCTGGG - Intergenic
1102715844 12:114971758-114971780 TATGACACAGATAGGCTCCTGGG + Intergenic
1103033472 12:117637268-117637290 TTTGACACTCATCCCCACCTCGG + Intronic
1105478234 13:20747935-20747957 TGAGACGTACATAGCTACCTTGG - Intronic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1110743072 13:79019670-79019692 TGTGACTCACCTTTCCACCTGGG - Intergenic
1113137907 13:107114075-107114097 TGTGAGTCACATAGCTGCCTTGG + Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1114521835 14:23344195-23344217 TGTGACTCACCCAGCCTCCTGGG + Intergenic
1114756551 14:25266767-25266789 TCTGACACACATGGCCACCTTGG - Intergenic
1115044517 14:28974921-28974943 TGTGACACACATAATCTACTAGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119032992 14:71207007-71207029 TGTGACTCACTCAGCCTCCTGGG - Intergenic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1120786797 14:88545450-88545472 GGTGACACAAGTGGCCACCTGGG - Intronic
1122939806 14:104976201-104976223 TGTGACACCCAGAGCCCACTGGG + Intronic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1126154836 15:45556210-45556232 TTTGATACACATGGCCACCTTGG + Intergenic
1126954678 15:53919370-53919392 TGAGGCACACATGGTCACCTAGG - Intergenic
1127331061 15:57940457-57940479 TCTGACACACACAGCTACGTGGG - Intergenic
1129419937 15:75416640-75416662 TTTAACACACATGGCCACCTTGG + Intronic
1129552916 15:76472826-76472848 TCTGAGACATGTAGCCACCTTGG + Intronic
1130933880 15:88452340-88452362 TGTCACACACACACACACCTTGG - Intergenic
1131709547 15:95038022-95038044 TGTGACTCCCAAAGCCACATTGG - Intergenic
1133313112 16:4863913-4863935 TGTGATACACATAGCCTCTAAGG - Intronic
1133615178 16:7469390-7469412 TGAGACAAACATAGCCTCATAGG - Intronic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1140282393 16:73566566-73566588 TGTGACACACAGAGACACTGGGG - Intergenic
1142454386 16:90209915-90209937 TGGGACACACAGAGCAGCCTAGG + Intergenic
1144029045 17:11303706-11303728 AGTGACACGCATGGCCAACTGGG - Intronic
1146647961 17:34587803-34587825 TGTGACAAACAAAGCCATCATGG - Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148231304 17:45936852-45936874 TGTGGCTCTCATAGCCTCCTGGG - Intronic
1149003403 17:51779711-51779733 TGTGAAACACACAGCTTCCTTGG + Intronic
1149896830 17:60434871-60434893 TTTGATACACATGGCCACCTTGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150331980 17:64301766-64301788 TGTAACACACATAGCCAGGGTGG + Intergenic
1150543128 17:66124169-66124191 TGTTCCACACATGTCCACCTTGG + Intronic
1153821467 18:8835634-8835656 TGTGACCCACATAGCAGCCTTGG - Intergenic
1155965677 18:32033245-32033267 TTTGACAAACACAGACACCTTGG - Intronic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1157578069 18:48757118-48757140 TTTGACACACAGAGACACCAGGG - Intronic
1158619116 18:59015642-59015664 CATGCCACACAGAGCCACCTGGG + Intergenic
1159703860 18:71662818-71662840 TGTGACACACACATCTACATGGG - Intergenic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1164155887 19:22596676-22596698 TGTGGCACTCAAAGTCACCTAGG - Intergenic
1165759536 19:38312760-38312782 TGTGACACTCATAAACTCCTTGG + Intronic
1165914876 19:39252123-39252145 TGAGACAGACAGAGCGACCTGGG - Intergenic
1166251687 19:41575876-41575898 TGTGACACACAAAACCAGCTGGG - Intronic
1166259419 19:41627363-41627385 TGTGACACAGAGACCCAGCTGGG + Intronic
1166415157 19:42589851-42589873 TGTGACACACACACCCACCGTGG - Intronic
927285043 2:21348391-21348413 TGTGACATATATTGCCAACTTGG - Intergenic
927588434 2:24331553-24331575 TTTAACACACATGGCCACCTTGG + Intronic
929240485 2:39648485-39648507 TCTTACACACACACCCACCTGGG + Intergenic
929324801 2:40596329-40596351 TGTGTCACACGTACCCATCTTGG + Intronic
929551453 2:42895704-42895726 TGTGACACACAATGCCACCCAGG - Intergenic
931456783 2:62415759-62415781 CGTGACACACATTGCCAGATTGG - Intergenic
932111159 2:69002010-69002032 TGTGGCACACATATACACCATGG - Intergenic
933022290 2:77208870-77208892 TGTGGTACAAATAGCCAACTGGG - Intronic
935168454 2:100590445-100590467 TTTGACACACATGACCACCTTGG - Intergenic
935338920 2:102042531-102042553 ACTGACACACATGGCCACCCTGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
936983892 2:118289943-118289965 TGTGACACACTTAGAGATCTGGG - Intergenic
937520872 2:122711424-122711446 TGTGACACACAGAGCTGCCGTGG + Intergenic
940525344 2:154807336-154807358 GGTGACACACATAGCACCCTTGG + Intronic
941848771 2:170158506-170158528 TGTGCCCCAGACAGCCACCTGGG - Intergenic
945117155 2:206419321-206419343 TGGAACAGCCATAGCCACCTTGG + Intergenic
945663418 2:212713622-212713644 TGTGACACACAGCGCCACACTGG + Intergenic
948897741 2:240935106-240935128 TGGGAGACCCACAGCCACCTGGG - Intronic
949085844 2:242154570-242154592 TGGGACACACAGAGCAGCCTAGG + Intergenic
1174049983 20:47760723-47760745 TGTGACTCTCAGAGCCACCTGGG - Intronic
1174670513 20:52303353-52303375 TGTGACAATCATAGCCACGATGG + Intergenic
1176013530 20:62914516-62914538 TGTGACCCACAAAGACAGCTTGG + Intronic
1180940587 22:19657685-19657707 TGGGGCCTACATAGCCACCTGGG + Intergenic
1180940861 22:19658869-19658891 TGGGGCCCACATAGCCACCTGGG - Intergenic
1182175279 22:28279682-28279704 TTTGACACACACATACACCTAGG + Intronic
1184005915 22:41708939-41708961 TTTGACACACGTGGCCACTTTGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
952269196 3:31815773-31815795 TGTGACACTCAAACCCCCCTTGG - Intronic
953192217 3:40698771-40698793 TTTGACACAGATGGTCACCTTGG - Intergenic
953253257 3:41265294-41265316 TGTGAGACACACCGTCACCTCGG + Intronic
954199024 3:49013265-49013287 TGGTATACACATAGCCACCATGG - Exonic
954614261 3:51961447-51961469 TGAGACACACATAAGCACCCTGG - Intronic
955480777 3:59387406-59387428 TCTGATGCACATAACCACCTAGG - Intergenic
955697166 3:61648378-61648400 TGTTTCACACATAGGCACCAAGG + Intronic
956974052 3:74559580-74559602 TGAGACACACACAACCAACTTGG + Intergenic
957338484 3:78862200-78862222 TGTGACAGACTCAACCACCTTGG + Intronic
957760598 3:84550084-84550106 TGATACACACATTTCCACCTTGG + Intergenic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
961375811 3:126465136-126465158 GGTGACACACACAGCCTCCACGG + Intronic
964396871 3:156255020-156255042 TGTCACCCACATAGTCAACTCGG - Intronic
970726310 4:19049300-19049322 TGTGACACTCATTGCCACTGAGG - Intergenic
973708023 4:53599301-53599323 GGTTACTCACATAGCCATCTTGG - Intronic
977287404 4:95125863-95125885 TGTGCCACACATACCAAGCTGGG - Intronic
979908865 4:126334232-126334254 TCTGACACTCATAACCACATCGG + Intergenic
980696783 4:136367405-136367427 AGTGACACACAGAGCAGCCTTGG - Intergenic
980835904 4:138192306-138192328 GGTGACACACTTAACCACCTTGG - Intronic
981431906 4:144671177-144671199 GGTGATATACATAGACACCTCGG - Intronic
982049035 4:151480890-151480912 TTTGACACACATACACACATAGG + Intronic
984187838 4:176567807-176567829 TGTGAGAGACACAGACACCTAGG - Intergenic
984438095 4:179729143-179729165 CGTGCCACACATGGCCACTTGGG + Intergenic
985084421 4:186298325-186298347 TGTGACACAGGAAGCCTCCTAGG + Intergenic
986480484 5:8181787-8181809 TGTGACAGACAGAGCCACTCTGG + Intergenic
986629478 5:9755875-9755897 GGTGACTCTCATAGCCATCTTGG + Intergenic
987576644 5:19736784-19736806 TGTGCCACACAGAGACACCATGG - Intronic
987777603 5:22389147-22389169 TGGGAGACTGATAGCCACCTAGG - Intronic
988708618 5:33751377-33751399 TGTGACTCACATGTCCTCCTGGG - Intronic
989113069 5:37926249-37926271 TCTGCCATACAGAGCCACCTGGG + Intergenic
989854839 5:46270979-46271001 TGTGGCACATATATACACCTTGG + Intergenic
990738025 5:58885491-58885513 TGAGTCACACTTAGCCTCCTCGG - Intergenic
992094915 5:73353935-73353957 TGTTACACAGAGAGCCTCCTGGG + Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
995819840 5:116217731-116217753 TTTGACACATATGGCCACCTTGG - Intronic
997968206 5:138376746-138376768 AGTTACACAAACAGCCACCTCGG - Intronic
998329419 5:141310832-141310854 TGTGGCACACATATACACCATGG - Intergenic
1001982560 5:176046901-176046923 TGGGACCTACACAGCCACCTGGG - Intergenic
1002234901 5:177797156-177797178 TGGGACCTACACAGCCACCTGGG + Intergenic
1005011685 6:21341949-21341971 TGGGGGACACAGAGCCACCTGGG - Intergenic
1007947566 6:45839849-45839871 TGTCACACACTTAGCCCACTGGG + Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1010918756 6:81654027-81654049 TATGAAATACATTGCCACCTTGG - Intronic
1011221768 6:85062109-85062131 TGCGACACACAAAGCCATTTTGG - Intergenic
1011370846 6:86634771-86634793 TCTGACACACAGAGCTACGTGGG - Intergenic
1013630223 6:111979469-111979491 TGAGATACACATTGACACCTGGG - Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015024068 6:128511781-128511803 AGTGACTCATATAGCCACTTGGG + Intronic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1023625787 7:42113898-42113920 TTTGATACACATGTCCACCTTGG + Intronic
1030641385 7:112010461-112010483 TGTGACACACATAGCCACCTGGG - Intronic
1031453954 7:121956776-121956798 TTTGACATACATGGCCACCTTGG - Intronic
1031894236 7:127329698-127329720 TGTGACACACATGTCCTCTTTGG + Intergenic
1033837193 7:145329749-145329771 GGTCACACCCATAGCCATCTTGG + Intergenic
1034789646 7:153956546-153956568 TGTGACACAGAGACCCACCTGGG - Intronic
1035727022 8:1831072-1831094 TCTGACACACAGAGCCTCCAAGG - Intronic
1038654719 8:29438725-29438747 TGTACCACACAGGGCCACCTGGG - Intergenic
1040342666 8:46448765-46448787 TGTGAGAGACACAGTCACCTTGG + Intergenic
1042677969 8:71343559-71343581 TGTGACACTCTGTGCCACCTTGG + Intronic
1042781130 8:72492116-72492138 TTTGAGACACATAGGCACCAAGG + Intergenic
1049766060 8:144355773-144355795 TCTGCCACCCATAGCCACCAAGG + Intronic
1049860548 8:144895345-144895367 TGTGACACACATACCCTTCATGG - Intronic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1051295362 9:15589184-15589206 ATTGACACACATAGCCACCTTGG + Intronic
1053156641 9:35785495-35785517 TGTGAAAAACATAGCCTCCAAGG + Intergenic
1055113418 9:72582508-72582530 TGAGATTCACATAGCCCCCTTGG + Intronic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1058683007 9:107456594-107456616 TTTGACACACTTGGCCACCTTGG - Intergenic
1059239088 9:112787719-112787741 TCTGAAACCCATAGGCACCTTGG - Intronic
1059415785 9:114161741-114161763 AGTGACACCCGAAGCCACCTGGG - Intronic
1059972784 9:119684712-119684734 TGGCACACACATAGCCACTGAGG - Intergenic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1188205155 X:27346778-27346800 TCTGACACACATAGACATTTAGG - Intergenic
1189249174 X:39586787-39586809 TGGGACAGACATGGCAACCTTGG - Intergenic
1190468540 X:50751858-50751880 TGTGACTTACATAGCTAGCTCGG - Intronic
1191175049 X:57490525-57490547 TGTGACACACATATACACTATGG - Intergenic
1196974306 X:121141807-121141829 TGTGCCACACATAGGGACCAGGG + Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic