ID: 1030649984

View in Genome Browser
Species Human (GRCh38)
Location 7:112107141-112107163
Sequence AATACCTCACAATCTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030649979_1030649984 2 Left 1030649979 7:112107116-112107138 CCATCTGTATAAGGCTCTGCCTT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1030649984 7:112107141-112107163 AATACCTCACAATCTAATGGGGG No data
1030649978_1030649984 3 Left 1030649978 7:112107115-112107137 CCCATCTGTATAAGGCTCTGCCT 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1030649984 7:112107141-112107163 AATACCTCACAATCTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030649984 Original CRISPR AATACCTCACAATCTAATGG GGG Intronic
No off target data available for this crispr