ID: 1030651901

View in Genome Browser
Species Human (GRCh38)
Location 7:112125242-112125264
Sequence TGGGATCATCCTGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030651901 Original CRISPR TGGGATCATCCTGATGGGGC AGG (reversed) Intronic
900383006 1:2394508-2394530 TGCGAACATGCTGATGGGCCAGG + Intronic
900417930 1:2543563-2543585 GGGGAGCTGCCTGATGGGGCTGG - Intergenic
901131211 1:6963240-6963262 TGGGAGGAGCCAGATGGGGCGGG - Intronic
902532801 1:17101343-17101365 TGGGATCATCCTCATTTGACAGG + Intronic
904493776 1:30875689-30875711 TGGGATATTCTGGATGGGGCAGG - Intronic
904999509 1:34657355-34657377 TGGGCTCCTTCTGTTGGGGCAGG - Intergenic
906465485 1:46074758-46074780 TGGGAAGACCCTGATGAGGCTGG - Intronic
910898587 1:92095019-92095041 TGGGGTCTTGCTGATGGGGTTGG + Intronic
916853486 1:168727028-168727050 AGGGATCATCCCTCTGGGGCTGG + Intronic
917970387 1:180202221-180202243 TGAGATCCTCCTGATAGTGCTGG + Exonic
918246078 1:182660699-182660721 CTGGAGCATCCTGGTGGGGCAGG - Intronic
919557931 1:199084408-199084430 TGCTTTCATCCTGCTGGGGCAGG - Intergenic
919790655 1:201288758-201288780 TGGGAGCATCCTGTGGGGACAGG - Intronic
920391888 1:205610174-205610196 TGGGATCTTCTGGATGGGGTCGG - Exonic
922136124 1:222828679-222828701 TGGAATGAACCTGATGGGGAGGG - Intergenic
922915978 1:229258124-229258146 TGGAATCACCCTGCTGGTGCTGG + Intergenic
923237502 1:232048370-232048392 TGGGTTCTTCCTGAGGGGCCTGG - Intergenic
923318608 1:232805894-232805916 TGGGAGCATCCGGAGGCGGCCGG - Exonic
1063238966 10:4148987-4149009 GGGGAGCATACAGATGGGGCAGG + Intergenic
1066167391 10:32801918-32801940 TGGGAGGACCCTGATGAGGCTGG - Intronic
1069603500 10:69724875-69724897 TGGGAGCACCCTGTTGGAGCAGG + Intergenic
1071710222 10:88042510-88042532 TGGGAGCATCCTGAAGGTACGGG + Intergenic
1074363399 10:112839824-112839846 TGGGACCATCTCCATGGGGCAGG + Intergenic
1075045466 10:119143026-119143048 TGGAAATATCCTGTTGGGGCCGG - Intronic
1075591642 10:123695901-123695923 TGGGGAAATCCTGATGGGGTTGG - Intergenic
1075958543 10:126546442-126546464 TGGCACCATCCTGGTGGGGAGGG - Intronic
1079252548 11:18797519-18797541 TGTGATCTTCCTGTAGGGGCTGG + Intergenic
1082708334 11:56520739-56520761 TGGGAAGATCCTGATGAAGCTGG - Intergenic
1084937777 11:72596205-72596227 TGGGATCCTCCAGATGGGGTGGG - Intronic
1086833769 11:91597715-91597737 TGGGATGACCCTGATGAAGCTGG + Intergenic
1089680740 11:120117631-120117653 TGGGGGCATCCTGAGGGGGCAGG - Intronic
1090022032 11:123136912-123136934 TGGAATCTTACTTATGGGGCTGG + Intronic
1092406435 12:8224712-8224734 TGGGATCTTCTTCATCGGGCGGG + Exonic
1093098084 12:14994980-14995002 TGGGAGAACCCTGATGAGGCTGG + Intergenic
1096221116 12:49828531-49828553 TGGGAACATCTGGAGGGGGCTGG - Intronic
1096738971 12:53677642-53677664 TGTGAGAATCCTGATGGAGCTGG - Intergenic
1097102416 12:56598992-56599014 TAGGATTATCCTGATGGAGATGG - Exonic
1097489012 12:60240891-60240913 TGGGGTCTTCCTGAGGGTGCAGG - Intergenic
1098837482 12:75440171-75440193 TGGCATCATGCTGATCTGGCAGG - Intergenic
1099508078 12:83503206-83503228 TGGGAGGACCCTGATGAGGCTGG + Intergenic
1101955607 12:109209375-109209397 TGTGACCATCCTGGTGGGGTGGG - Intronic
1102818782 12:115890382-115890404 TGGGATGATCCAGATGGGAAAGG - Intergenic
1102924065 12:116813429-116813451 AGGGGTCAGCCAGATGGGGCTGG - Intronic
1105217100 13:18294334-18294356 TGGGAGCGTCCAGATGGAGCAGG - Intergenic
1105344628 13:19561288-19561310 TGGGATCGGCATGCTGGGGCAGG - Intergenic
1105535409 13:21260283-21260305 TGGGATCGGCATGCTGGGGCAGG + Intergenic
1106161538 13:27205264-27205286 TGAGATCATCATTGTGGGGCAGG - Intergenic
1107523490 13:41206185-41206207 TGGGATCCCCATGATGGGACTGG + Intergenic
1107556419 13:41519928-41519950 TTGGCTTCTCCTGATGGGGCTGG - Intergenic
1107806444 13:44158023-44158045 TGGGATCACCTTGACGTGGCAGG + Intronic
1108454548 13:50599678-50599700 TGGGCTCATCCTCCTGAGGCTGG + Intronic
1110250199 13:73372568-73372590 TGGGAGCCTCCTGATGGGGCTGG + Intergenic
1110414073 13:75233369-75233391 TGGGATCTTACTGTTGGGGTTGG - Intergenic
1110569898 13:76992086-76992108 TGGGTGCAGCCTGATGGCGCAGG + Exonic
1111404355 13:87783006-87783028 TGTGTTCATCCGGATGAGGCTGG + Intergenic
1113943314 13:114029618-114029640 TGGCGTCATCCTGGTGGGCCAGG + Intronic
1114408229 14:22476098-22476120 TGGGACCATCCTGACGTGGCTGG + Intergenic
1118380948 14:65217073-65217095 TGGGAACAGCCTGAAGAGGCTGG - Intergenic
1119265440 14:73261176-73261198 TGGGCTCATTCTGCTGGGCCTGG - Exonic
1120056545 14:79930727-79930749 TGGGAAGATCCTGATGAAGCTGG - Intergenic
1120148051 14:81001352-81001374 AAGGATCATCTTGATGTGGCAGG + Intronic
1121226332 14:92324047-92324069 TGGGACCAACCTGATGAGGAAGG - Intronic
1122409033 14:101516819-101516841 GGGGAACATCCTGGCGGGGCAGG - Intergenic
1122445145 14:101762157-101762179 TGGGACCTTCGTGATGGGCCGGG + Intronic
1122784751 14:104158522-104158544 TGGGATGCTCCTGGTGGAGCTGG - Intronic
1124363105 15:29053356-29053378 TGGGATAAGCCTGAAGGGGAAGG + Intronic
1125584248 15:40809061-40809083 TGGGAGCAGCCTGCAGGGGCGGG + Intronic
1132072960 15:98796028-98796050 TGGGATCAGCCAGATGGAGCAGG - Intronic
1132243421 15:100277149-100277171 TGGGATCACCCTTATTAGGCAGG + Intronic
1132463849 16:68610-68632 TGGGTGTCTCCTGATGGGGCTGG - Intronic
1134349016 16:13418973-13418995 TGGGGACATCCTAAAGGGGCTGG + Intergenic
1134825862 16:17283778-17283800 TGTGATAATAGTGATGGGGCTGG - Intronic
1137287240 16:47026552-47026574 GTGGATCATCCTAATGAGGCGGG + Intergenic
1139589797 16:67927258-67927280 TGGCCTCATCCAGATGGGGTGGG + Intronic
1140091860 16:71845776-71845798 TGGGGTCAGGCTGAGGGGGCCGG + Intergenic
1141623713 16:85250403-85250425 TGGGAACACCCAGCTGGGGCGGG - Intergenic
1143317807 17:6045892-6045914 TTGGCTCATTCTGATAGGGCTGG + Intronic
1144614686 17:16757909-16757931 TGAGATGATCCTGGTTGGGCTGG + Intronic
1146758469 17:35454487-35454509 TGGGAACACCCTGATGAAGCTGG + Intergenic
1147217449 17:38908928-38908950 TGGGACAGCCCTGATGGGGCAGG + Intronic
1151748714 17:76024949-76024971 GGGGATCATTATGCTGGGGCAGG + Intronic
1154367274 18:13722560-13722582 TGGGAACATCCTGATGAAGCTGG - Intronic
1156399761 18:36729663-36729685 TGGGATCCTCATGACGGGACTGG - Intronic
1161107743 19:2453053-2453075 CTGGGTCATCCTCATGGGGCTGG + Intronic
1162791770 19:13066698-13066720 TGGAGTCATCCTGAGGTGGCAGG - Intronic
1164415791 19:28045618-28045640 TGGGCTCGTCCTGATGAGGATGG - Intergenic
1164417560 19:28059361-28059383 TTGGCTGATCCTGATGGGGATGG + Intergenic
1165832165 19:38735658-38735680 TGGGCTCATCCTCGCGGGGCGGG + Intronic
1166545740 19:43634165-43634187 GGGGCTCATCCTTATGAGGCAGG - Intronic
1167080929 19:47275552-47275574 TGGGATCTTCCTGATGGTGGAGG - Exonic
1167148151 19:47694747-47694769 TGGGATGGGGCTGATGGGGCGGG - Intronic
1167882271 19:52470018-52470040 TGGGAGGATCCTGATGAAGCTGG + Intronic
1168694127 19:58395511-58395533 GGTGTTCATCCTGGTGGGGCTGG + Intergenic
925346503 2:3175595-3175617 TGGGCTCCTCCTGAAGGTGCAGG - Intergenic
931710802 2:64988508-64988530 TGGGGCCATCAGGATGGGGCTGG - Intronic
934297224 2:91752348-91752370 TGGGAGCGTCCAGATGGAGCAGG + Intergenic
934859237 2:97749929-97749951 TGGCAACTTCCTGATGGGGATGG - Intergenic
936109862 2:109656084-109656106 TAGGATCATCCTGCTGAGGCAGG - Intergenic
937291592 2:120785290-120785312 TGGGATCTTCATGATGAGGTAGG - Intronic
937800914 2:126079187-126079209 TGGGGTGATCCTGAAGGGTCTGG - Intergenic
938096175 2:128465633-128465655 GGGGACCATCCTGAGGGGGCAGG - Intergenic
938719605 2:134054601-134054623 TTGGTTCATCCTGAAAGGGCAGG + Intergenic
941230276 2:162903633-162903655 TGGGATCCTCATGATGGGACTGG + Intergenic
941507238 2:166361946-166361968 TGAAATATTCCTGATGGGGCAGG + Intronic
943006207 2:182390772-182390794 TGGGAAGACCCTGATGAGGCTGG + Intronic
943092002 2:183386618-183386640 TGGGGTCTTCCTGATGGTGAAGG - Intergenic
945164886 2:206932702-206932724 CGGGGTCATACTGATGTGGCTGG + Intergenic
948192091 2:236067244-236067266 TGAAATCATCCTGATGAGGCAGG - Intronic
948423636 2:237875164-237875186 AGGGGGCATCTTGATGGGGCAGG + Intronic
1171257757 20:23703743-23703765 TTGGATCCACCTGATGGGGAAGG + Intergenic
1171265245 20:23766408-23766430 TTGGATCTACCTGATGGGGAAGG + Intergenic
1171274837 20:23847754-23847776 TTGGATCCACCTGATGGGGAAGG + Intergenic
1171448124 20:25218818-25218840 TGGTGGCACCCTGATGGGGCAGG + Intronic
1173834429 20:46115984-46116006 TTGGATCATCCTGAGGGTGCAGG + Intergenic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
1179150099 21:38802452-38802474 TGGGTCCACCCTGATGGAGCAGG + Intergenic
1179659528 21:42865539-42865561 TGGGAGCCTCCGGCTGGGGCAGG - Intronic
1183959969 22:41405662-41405684 TGGCCTCATCCTGATATGGCAGG - Intergenic
1184700845 22:46171631-46171653 TGGGAGCATCCTGACAGGGAGGG + Intronic
1185210522 22:49568330-49568352 TGGGCTCATTCTGCTGGGGAAGG - Intronic
949892856 3:8746066-8746088 TGGGGGCATCATGGTGGGGCTGG - Exonic
952308466 3:32166584-32166606 TGGGATTTTCCTGCTGTGGCTGG + Exonic
954086424 3:48247563-48247585 GGGGATCCTCATGATGGGCCTGG + Intronic
954652928 3:52176257-52176279 TGGGGTGATCCTGGTGGGGCGGG - Intergenic
959746359 3:109779920-109779942 TGGGAGGACCCTGATGGAGCTGG - Intergenic
960163557 3:114376620-114376642 TAGCATCATTCTGCTGGGGCTGG - Intronic
960349202 3:116573310-116573332 TGGGAGCACCCTGATGAAGCTGG + Intronic
961350881 3:126301159-126301181 TGGGTACATTTTGATGGGGCAGG - Intergenic
964873207 3:161336055-161336077 TGTGATCATCTGGATGGGACCGG + Intergenic
966086156 3:176068921-176068943 TGGGAGCACCCTGGTGGGGCTGG + Intergenic
966629775 3:182059533-182059555 TGGCAGCATGGTGATGGGGCAGG - Intergenic
966742101 3:183243298-183243320 TGGGAGGATCCTGATGAAGCTGG - Intronic
967505641 3:190249859-190249881 TGGGAGGACCCTGATGGAGCTGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969494163 4:7516396-7516418 TGGCTTCATCCTGAAGGTGCTGG + Intronic
969674600 4:8607872-8607894 TGGGCTCCTCCGGATGGGGAAGG + Intronic
969719535 4:8885613-8885635 AGGGATCATTTGGATGGGGCTGG + Intergenic
969759700 4:9173271-9173293 TGGGATCTTCTTCATCGGGCGGG - Exonic
970629169 4:17922775-17922797 TGGGAGAAACCTGATGAGGCTGG + Intronic
970678652 4:18482005-18482027 TGGGGTCAACTTGATGGGGGAGG - Intergenic
972048255 4:34695703-34695725 TGGGAAGACCCTGATGAGGCTGG - Intergenic
974636638 4:64572393-64572415 TGGACTCATTCTAATGGGGCAGG - Intergenic
984109617 4:175596038-175596060 TGGGATCACCAGGATGGGACTGG + Intergenic
985527368 5:413727-413749 TGGGATGGTGCTGGTGGGGCAGG - Intronic
985547395 5:516550-516572 TGGCAACATCAGGATGGGGCTGG + Intronic
985623835 5:973308-973330 TGGGATCTACCTGAGGGGGGAGG + Intergenic
986524984 5:8664116-8664138 TGGGAGGACCCTGATGAGGCTGG + Intergenic
986959486 5:13196529-13196551 TGGGAGGACCCTGATGAGGCTGG + Intergenic
987173098 5:15279219-15279241 TGGGATCTCCATGATGGGACTGG + Intergenic
989301702 5:39902790-39902812 TGGGATCTTCCAGCTGTGGCTGG - Intergenic
990905879 5:60802333-60802355 TGGGAAAATTCTGATGGGCCAGG + Intronic
990943944 5:61230535-61230557 TGGGATCCTCATGATGGGAGTGG + Intergenic
994282284 5:97919981-97920003 TGGGTTTAAACTGATGGGGCAGG + Intergenic
995536159 5:113138410-113138432 TGGGGTCCTCATGATGGGACTGG + Intronic
995599235 5:113777673-113777695 TGAGGTCATCCTTATGAGGCAGG - Intergenic
999107458 5:149086342-149086364 TGGGTCCATCCTGATGTGGTGGG + Intergenic
999140528 5:149358313-149358335 AGGGAAGGTCCTGATGGGGCCGG + Intronic
999257889 5:150219979-150220001 AGGGATGATCCTGATGTGGCAGG - Intronic
999721481 5:154402069-154402091 GGAGAACAGCCTGATGGGGCAGG - Intronic
1002983432 6:2164590-2164612 TGGGAAGATCCTGATGAAGCTGG - Intronic
1004591151 6:17053207-17053229 TGGGGTCATCCTAATGGAGATGG - Intergenic
1006580243 6:35072915-35072937 TCGGCTCTTCCTGCTGGGGCAGG - Intronic
1007236239 6:40392903-40392925 TGGGATCATCCTGGGGAGGGAGG + Exonic
1007636788 6:43304589-43304611 TGGGACAGCCCTGATGGGGCAGG + Intronic
1008555581 6:52670587-52670609 TGGGATCATCTAGATGTGGTTGG - Intergenic
1008801970 6:55379317-55379339 TGGGGTCTCCCTGATGGGGGAGG - Intronic
1021294299 7:18885207-18885229 TGGGATAATTCTGATGGCCCAGG - Intronic
1023093745 7:36640068-36640090 TGGGTTCATCTGGATGTGGCTGG + Intronic
1023162192 7:37308384-37308406 TAGGACCATCCAGATGTGGCTGG - Intronic
1023220035 7:37912144-37912166 TGAGAACATCTTGATGGGGCAGG + Exonic
1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG + Intronic
1026978590 7:74513673-74513695 TGACATCAACCTGAGGGGGCAGG + Intronic
1027407165 7:77873741-77873763 TGGGAGGACCCTGATGAGGCAGG - Intronic
1030651901 7:112125242-112125264 TGGGATCATCCTGATGGGGCAGG - Intronic
1034794207 7:153998002-153998024 TGGAGACATCCTGATGGTGCTGG - Intronic
1035342427 7:158172475-158172497 TGGGATGATGCTGATGGTGAGGG - Intronic
1035342493 7:158172884-158172906 TGGGATGATGCTGATGGTGAAGG - Intronic
1035342542 7:158173176-158173198 TGGGATGATGCTGATGGTGAGGG - Intronic
1035563862 8:628513-628535 TGGGGTCACCCTGATCGGCCTGG - Intronic
1036263292 8:7257002-7257024 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036264595 8:7264624-7264646 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036265894 8:7272246-7272268 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036267196 8:7279868-7279890 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036268499 8:7287490-7287512 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036269803 8:7295112-7295134 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036298088 8:7551942-7551964 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036299393 8:7559592-7559614 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036300698 8:7567240-7567262 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036302005 8:7574886-7574908 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036303300 8:7582533-7582555 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036315336 8:7715541-7715563 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036316640 8:7723189-7723211 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036317947 8:7730837-7730859 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036319254 8:7738485-7738507 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036320563 8:7746132-7746154 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036321873 8:7753780-7753802 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036323182 8:7761428-7761450 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036324483 8:7769075-7769097 TGGGATCTTCTTCATCGGGCGGG - Intergenic
1036351551 8:8015232-8015254 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036352861 8:8022878-8022900 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036354150 8:8030526-8030548 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1036846809 8:12175651-12175673 TGGGATCTTCTTCATCGGGCGGG + Intergenic
1037908007 8:22726821-22726843 TGGGGGCATCCTCCTGGGGCAGG + Intronic
1041985838 8:63921802-63921824 TGGGAGGACCCTGATGAGGCTGG + Intergenic
1042639671 8:70919647-70919669 TGGGATCACTGTGATAGGGCAGG - Intergenic
1048303990 8:133270905-133270927 TGGGAGCATCTTAATGGAGCAGG - Intronic
1048910397 8:139129317-139129339 TGGGAACATCCTGATGAAGCTGG - Intergenic
1049217488 8:141414874-141414896 GGGCAGCATCCTGATGGGGGAGG + Intronic
1049355874 8:142187748-142187770 GGGCATCATCCTCATGGGCCAGG + Intergenic
1051433228 9:17002122-17002144 TGTGATCATCCTGATAGAGTAGG + Intergenic
1052789332 9:32859953-32859975 TGGGAGGACCCTGATGAGGCTGG - Intergenic
1055205283 9:73722578-73722600 TGGGAGGATCCTGATGAAGCCGG + Intergenic
1056127396 9:83549107-83549129 TGGGGTCTTCTTGAGGGGGCAGG - Intergenic
1056824809 9:89869651-89869673 TGGGTTCACCCTGAGGGAGCAGG + Intergenic
1057527018 9:95811782-95811804 TGGGAGCATCCTGATCTGGAGGG + Intergenic
1060224467 9:121782744-121782766 TGGGGACAGCCTGATGGGGCAGG + Intronic
1060599925 9:124870616-124870638 TTGGGAGATCCTGATGGGGCAGG - Intronic
1185996336 X:4954050-4954072 TGGGATCTACCTGAAGGGGGTGG + Intergenic
1189305524 X:39984185-39984207 TGGGATCATTCTGATTGGGGTGG - Intergenic
1189735567 X:44066362-44066384 TGGGACCAGGCTTATGGGGCTGG + Intergenic
1191009641 X:55747240-55747262 TGGGAAGATCCTGATGAAGCTGG - Intronic
1191995295 X:67089014-67089036 TGGGACCATCCTTATGGACCTGG + Intergenic
1195321068 X:103722468-103722490 TGGGCCCATCCTGAGTGGGCAGG + Intronic
1196868188 X:120087944-120087966 GGTGATCATCCTTATGGGACAGG + Intergenic
1197404738 X:126036502-126036524 TGGGAGCACCCTGATGAAGCTGG + Intergenic
1197421033 X:126237536-126237558 TGGGATCATGCTTGGGGGGCTGG + Intergenic