ID: 1030652715

View in Genome Browser
Species Human (GRCh38)
Location 7:112132707-112132729
Sequence TATCCAATACAGAAAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030652710_1030652715 14 Left 1030652710 7:112132670-112132692 CCTCCATTCAATATCCTTGGTTA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG No data
1030652711_1030652715 11 Left 1030652711 7:112132673-112132695 CCATTCAATATCCTTGGTTATTG 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG No data
1030652713_1030652715 0 Left 1030652713 7:112132684-112132706 CCTTGGTTATTGGATATTGAAAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030652715 Original CRISPR TATCCAATACAGAAAGTAGG AGG Intronic
No off target data available for this crispr