ID: 1030653300

View in Genome Browser
Species Human (GRCh38)
Location 7:112138981-112139003
Sequence CTGTGCAGGTACATTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 402}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030653291_1030653300 14 Left 1030653291 7:112138944-112138966 CCTAACCCTAACCCCTCTGCAGG 0: 1
1: 0
2: 1
3: 20
4: 275
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653289_1030653300 20 Left 1030653289 7:112138938-112138960 CCTAACCCTAACCCTAACCCCTC 0: 1
1: 88
2: 217
3: 1552
4: 1692
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653294_1030653300 9 Left 1030653294 7:112138949-112138971 CCCTAACCCCTCTGCAGGTAGGC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653295_1030653300 8 Left 1030653295 7:112138950-112138972 CCTAACCCCTCTGCAGGTAGGCA 0: 1
1: 0
2: 1
3: 9
4: 179
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653296_1030653300 3 Left 1030653296 7:112138955-112138977 CCCCTCTGCAGGTAGGCAAGAAT 0: 1
1: 0
2: 2
3: 11
4: 127
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653298_1030653300 1 Left 1030653298 7:112138957-112138979 CCTCTGCAGGTAGGCAAGAATCA 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653290_1030653300 15 Left 1030653290 7:112138943-112138965 CCCTAACCCTAACCCCTCTGCAG 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402
1030653297_1030653300 2 Left 1030653297 7:112138956-112138978 CCCTCTGCAGGTAGGCAAGAATC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG 0: 1
1: 0
2: 4
3: 35
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030653300 Original CRISPR CTGTGCAGGTACATTGATCT TGG Intronic
902115153 1:14115120-14115142 ATCTGCAGGTACCTTGCTCTTGG - Intergenic
902416077 1:16240254-16240276 CTCTGCTGGCACCTTGATCTTGG - Intergenic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
904367871 1:30027898-30027920 ATCTGCAGGTTCCTTGATCTTGG + Intergenic
906697650 1:47834423-47834445 CTGAGCATGTACATAGCTCTGGG - Intronic
907240233 1:53077185-53077207 TTGTGCAGGTACACAGACCTGGG - Exonic
908076151 1:60521131-60521153 CTCTGCTGGCACCTTGATCTTGG - Intergenic
908084268 1:60613764-60613786 CTGTGGATGGACACTGATCTTGG + Intergenic
908341034 1:63179345-63179367 ATCTGCTGGTACCTTGATCTTGG + Intergenic
908564728 1:65342488-65342510 ATCTGCAGGCACCTTGATCTTGG + Intronic
909109631 1:71458083-71458105 CTTTGCAGTTAAATAGATCTAGG - Intronic
909601845 1:77469152-77469174 CTGAGCAGTTCCACTGATCTAGG + Intronic
910445883 1:87298681-87298703 ATCTGTAGGTGCATTGATCTTGG + Intergenic
910968103 1:92828198-92828220 CCATGCAGGCACCTTGATCTCGG - Intergenic
911094294 1:94043167-94043189 CTCTGCAGGGAAAATGATCTGGG + Intronic
911349876 1:96740260-96740282 CCTTGCTGGTACCTTGATCTTGG - Intronic
912351031 1:109013186-109013208 ATCTGCTGGTACCTTGATCTTGG + Intronic
912434435 1:109650573-109650595 ATTTGCAGGAGCATTGATCTTGG - Intergenic
912941430 1:114048628-114048650 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
913425941 1:118729576-118729598 ATCTGCCGGCACATTGATCTTGG + Intergenic
914384149 1:147151305-147151327 CAGTGCCGGTGCCTTGATCTAGG - Intergenic
915618490 1:157061672-157061694 CAGTGCTGGTACCCTGATCTTGG - Intergenic
915824770 1:159063804-159063826 CTGTGCAGGTCCATTTATATGGG + Intronic
915826377 1:159082414-159082436 ATATGCTGGTACCTTGATCTTGG - Intronic
916105312 1:161425640-161425662 ATGTGCAAGCACCTTGATCTTGG + Intergenic
916258757 1:162819210-162819232 CTGTGCAGGTAGAGTGAACCTGG + Intergenic
916358792 1:163943845-163943867 CTGTGTAGCTACAGTGGTCTAGG + Intergenic
916942376 1:169689298-169689320 CAGCCCAGGCACATTGATCTTGG + Intronic
917255992 1:173116761-173116783 ATGTGCCAGTACCTTGATCTTGG + Intergenic
918759666 1:188386839-188386861 ATCTGCTGGTACTTTGATCTTGG + Intergenic
919511435 1:198470296-198470318 GTTTGCAGGTACCTTGATCTTGG + Intergenic
919980501 1:202640088-202640110 CTTTGCAGGTAGATATATCTAGG - Intronic
920761826 1:208791420-208791442 CTGAGCAGCTACATTAATTTAGG - Intergenic
921132459 1:212231520-212231542 ATCTGCTGGTACTTTGATCTTGG + Intergenic
921753494 1:218825006-218825028 ATCTGCAGGTGCATTGACCTTGG + Intergenic
921990333 1:221359316-221359338 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922070744 1:222190716-222190738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922224637 1:223634608-223634630 CTCTGCTGGTGCTTTGATCTTGG - Intronic
922929396 1:229377041-229377063 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922975489 1:229780213-229780235 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
923007218 1:230060094-230060116 CTCTTCAGGTCCATTAATCTGGG + Intronic
923155800 1:231278486-231278508 CTATGCAAGTACCTTGATCTGGG - Intergenic
1064937719 10:20697186-20697208 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1066298537 10:34076715-34076737 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1066725206 10:38384883-38384905 CTGTGCAGGTAGAGTGAACCTGG + Intergenic
1067549058 10:47220531-47220553 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1069807546 10:71135472-71135494 ATTTGCTGGTACCTTGATCTTGG - Intergenic
1070908371 10:80095047-80095069 CTGTTCAGTTACATTGGTGTGGG + Intergenic
1071889307 10:89985301-89985323 CTGTGAAGGTACATGGAGGTGGG - Intergenic
1072057169 10:91771159-91771181 ATGTGCTGGTACCTTGATCTTGG - Intergenic
1072199187 10:93143406-93143428 CTTTGCAGTTAGATTGCTCTGGG + Intergenic
1073511122 10:104043174-104043196 CTCTGGAGGTAGACTGATCTGGG + Intronic
1073588666 10:104735215-104735237 CTGTGCTGCTGCATTGTTCTTGG + Intronic
1073998399 10:109342077-109342099 CTTTGCTGGTACCTTGATCTTGG + Intergenic
1074246390 10:111697989-111698011 AGGTGCCAGTACATTGATCTTGG - Intergenic
1075570430 10:123538002-123538024 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1076283150 10:129267504-129267526 CAGTGTAGGTACATTTATATGGG + Intergenic
1076939396 10:133591441-133591463 CTGTCCAAGTGCAGTGATCTGGG - Intergenic
1077869963 11:6253509-6253531 ATGTGTTGGTACCTTGATCTGGG - Intergenic
1081044263 11:38251495-38251517 TCCTGCAGGCACATTGATCTTGG - Intergenic
1081063808 11:38513972-38513994 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1082008879 11:47437361-47437383 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1082770946 11:57206985-57207007 CTGTGCAAGTACATTGATGATGG - Intergenic
1083354584 11:62056691-62056713 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1083355511 11:62063292-62063314 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1085625646 11:78070364-78070386 CTGTGCTGGTACCCTGATCTTGG + Intronic
1086643313 11:89186962-89186984 CTCAGCAGATACCTTGATCTTGG + Intronic
1086740403 11:90361161-90361183 CTGTTCTGTTCCATTGATCTAGG + Intergenic
1086744726 11:90410776-90410798 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1086899997 11:92356496-92356518 CTGTGCTGGTGCCCTGATCTTGG - Intronic
1087215502 11:95488716-95488738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1088361021 11:108990112-108990134 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1090345429 11:126065422-126065444 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1090474700 11:127009416-127009438 ATCTGCAGGCACTTTGATCTCGG - Intergenic
1090921588 11:131210981-131211003 CTGTTCAGGAACATAGAGCTTGG + Intergenic
1091409608 12:230400-230422 CTTTGAAGTTACATTAATCTGGG + Intronic
1092319938 12:7461187-7461209 CTTTGCAGGGACATTATTCTTGG - Intronic
1093378057 12:18455612-18455634 ATCTGCTGGTACCTTGATCTTGG - Intronic
1094254260 12:28403396-28403418 ATCTGCAGGTACCTTGATCTTGG - Intronic
1094756683 12:33477891-33477913 ATGTGCTGGCACATTGATCTTGG + Intergenic
1095041975 12:37453454-37453476 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1095181906 12:39155548-39155570 ATCTGCTGGCACATTGATCTTGG + Intergenic
1095453853 12:42361272-42361294 ATCTGCTGGTACCTTGATCTTGG + Intronic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1097424553 12:59427478-59427500 AGGTGCAGGCACTTTGATCTTGG - Intergenic
1097523468 12:60699911-60699933 ATCTGCTGGTGCATTGATCTTGG - Intergenic
1098084778 12:66830546-66830568 CTGTGCTGATACCTTGATTTTGG + Intergenic
1098450885 12:70617045-70617067 CTGTGCAGGTCCATTTATACGGG - Intronic
1098527024 12:71498402-71498424 ATCTGCTGGTACCTTGATCTTGG - Intronic
1099803287 12:87483467-87483489 ACTTGCAGGTACTTTGATCTTGG + Intergenic
1099891883 12:88599219-88599241 CTCTGCTGGCACTTTGATCTTGG - Intergenic
1100194832 12:92233447-92233469 CTGTGCAGCTTCGTTCATCTGGG - Intergenic
1100218971 12:92483207-92483229 CCCTGCAGATACCTTGATCTAGG + Intergenic
1100944764 12:99768955-99768977 CTCTGCTGGTACCTTCATCTTGG + Intronic
1101413705 12:104490545-104490567 TTGTGCTTGTACCTTGATCTGGG - Intronic
1101629918 12:106483227-106483249 CTGTGCAGGTCCACTTATATGGG - Intronic
1102318695 12:111912161-111912183 ATGAGCAGGTACATGGAACTTGG + Intergenic
1104558679 12:129824680-129824702 ATCTGCAGGCACCTTGATCTGGG + Intronic
1104695616 12:130861397-130861419 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1106130259 13:26933778-26933800 GTCTGCTGGTACCTTGATCTTGG + Intergenic
1106277625 13:28228099-28228121 CTGAGTAGGCACATTGCTCTGGG - Intronic
1106537843 13:30663549-30663571 ATGTGCTGATACCTTGATCTTGG - Intergenic
1107397448 13:40032566-40032588 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG + Intronic
1108109320 13:47051200-47051222 ATATGCAGGCACCTTGATCTTGG - Intergenic
1108415650 13:50195943-50195965 TTCTGCTGGTACTTTGATCTTGG - Intronic
1108423851 13:50278119-50278141 CTGAGCCGGTTTATTGATCTGGG + Intronic
1108500039 13:51061359-51061381 CTGTGCAGGGCCATGGGTCTGGG + Intergenic
1108984908 13:56574790-56574812 ATTTGCTGGTGCATTGATCTTGG - Intergenic
1109047475 13:57431934-57431956 CTATGCTGTTCCATTGATCTAGG - Intergenic
1109357489 13:61248936-61248958 CTGTACGGGCACCTTGATCTTGG + Intergenic
1109977781 13:69862843-69862865 ATTTGCAGGCACCTTGATCTTGG + Intronic
1110413919 13:75231905-75231927 ATCTGCTGGCACATTGATCTTGG + Intergenic
1111883478 13:93988530-93988552 ATGTGCTGGCACCTTGATCTTGG - Intronic
1112167263 13:96932723-96932745 ATGTGTAGGTACATTGTTCTTGG + Intergenic
1112414577 13:99193625-99193647 CTTTGCTGGTGCCTTGATCTTGG - Intergenic
1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG + Intronic
1112732548 13:102381516-102381538 ATTTGCTGGTGCATTGATCTTGG + Intronic
1113085957 13:106569842-106569864 CTCTGCTGGTACCTTTATCTTGG - Intergenic
1113294135 13:108939097-108939119 CTGTGCAGGCATATTAGTCTTGG - Intronic
1115423604 14:33227508-33227530 CCATGCTGGTACCTTGATCTTGG - Intronic
1116367850 14:44090824-44090846 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1117437665 14:55732449-55732471 CCTTGCAGGAACCTTGATCTTGG - Intergenic
1117855383 14:60025766-60025788 CTTTGGAGGTAGATAGATCTAGG - Intronic
1121881449 14:97503944-97503966 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1123672535 15:22673893-22673915 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1124324585 15:28747182-28747204 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1124485389 15:30110177-30110199 CAGTGGAAGTACATTGATATAGG + Intergenic
1124518187 15:30387090-30387112 CAGTGGAAGTACATTGATATAGG - Intronic
1124540466 15:30579163-30579185 CAGTGGAAGTACATTGATATAGG + Intergenic
1124758187 15:32428418-32428440 CAGTGGAAGTACATTGATATAGG - Intergenic
1126292973 15:47102074-47102096 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1126743494 15:51801520-51801542 CTGTGCTGTTAAATTGGTCTTGG - Intronic
1126910965 15:53416416-53416438 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1127197024 15:56598521-56598543 CTGTGAAAGAACATTCATCTCGG + Intergenic
1130031462 15:80318177-80318199 ATCTGCTGGTACTTTGATCTAGG - Intergenic
1130318545 15:82818797-82818819 ATCTGCAGGCACCTTGATCTTGG - Intronic
1130363750 15:83213831-83213853 CTCTGCTGGTGCATTGATCTTGG + Intergenic
1132300018 15:100769384-100769406 CTGTGCCGGGACCTTGCTCTAGG + Intergenic
1134002532 16:10793965-10793987 GTGTGCTGGCACCTTGATCTTGG - Intronic
1134503962 16:14790583-14790605 ATCTGCAGGTGCCTTGATCTGGG + Intronic
1134576610 16:15338325-15338347 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1134725829 16:16418174-16418196 ATCTGCAGGTGCCTTGATCTGGG + Intergenic
1134941604 16:18293685-18293707 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1135059879 16:19262384-19262406 ATCTGCTGGTACCTTGATCTGGG + Intronic
1135506111 16:23037839-23037861 TTGTGCAGCTACTTTGTTCTGGG - Intergenic
1135972106 16:27079917-27079939 CTGTGCTGGCACCTTGATCTTGG - Intergenic
1136083298 16:27867202-27867224 CTGAGCTTGTGCATTGATCTGGG - Intronic
1140231864 16:73123911-73123933 ATTTGCCAGTACATTGATCTTGG + Intergenic
1140786693 16:78349081-78349103 CTGTGCCGGAACCTTGACCTTGG - Intronic
1141711697 16:85703304-85703326 ATGTGCTGGCACCTTGATCTTGG + Intronic
1143713261 17:8748486-8748508 CTGTCCTGGCACCTTGATCTTGG + Intergenic
1144043760 17:11436267-11436289 CTTTGCTGGTATCTTGATCTTGG + Intronic
1144287307 17:13789384-13789406 GTTTGCTGGTACCTTGATCTTGG + Intergenic
1144922559 17:18776540-18776562 CTGTACAGGTACACTGACATAGG - Intronic
1148537648 17:48454131-48454153 ATCTGCTGGTACGTTGATCTTGG - Intergenic
1149360009 17:55885193-55885215 ATTTGCTGGCACATTGATCTTGG + Intergenic
1149888415 17:60364087-60364109 ATCTGCTGGTACTTTGATCTTGG - Intronic
1150369005 17:64619616-64619638 CTCTGCTGGCACCTTGATCTTGG - Intronic
1150717697 17:67585901-67585923 CCCTGCAGGCACATTGATCTTGG + Intronic
1153191507 18:2545666-2545688 TTGTTTAGGTACATTGATATCGG - Intronic
1153519839 18:5941242-5941264 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1153810419 18:8747372-8747394 CCCTGCAGGCACCTTGATCTTGG - Intronic
1155319543 18:24605444-24605466 CTTTGCCGGCACCTTGATCTTGG + Intergenic
1155826081 18:30444897-30444919 CTGTAGAGGTACATTGATCTGGG + Intergenic
1156155002 18:34291259-34291281 ATCTGCAGGTACATTATTCTTGG - Intergenic
1156525738 18:37765762-37765784 GTCTGCAGGCACCTTGATCTTGG - Intergenic
1157674429 18:49558546-49558568 CTATGCTGGTACCCTGATCTTGG + Intergenic
1157747024 18:50144857-50144879 CTGTGCATGTGAAGTGATCTGGG - Intronic
1158180982 18:54714642-54714664 CTGTGCTGGCACTCTGATCTTGG - Intergenic
1163172384 19:15541262-15541284 CCCTGCAGATACCTTGATCTTGG - Intronic
1165038478 19:33052048-33052070 CCGTGCTGGCACCTTGATCTTGG + Intronic
1165174418 19:33916977-33916999 CCCTGCTGGTACCTTGATCTTGG + Intergenic
925233256 2:2254421-2254443 CTGTGATGGGACATTGATGTGGG + Intronic
926144688 2:10389529-10389551 CTGTGCTGGCACCTTGATCTTGG + Intronic
926736579 2:16078076-16078098 TTCTGCAGATACCTTGATCTTGG + Intergenic
926840371 2:17073141-17073163 ATCTGCTGGTACCTTGATCTTGG + Intergenic
927084673 2:19662694-19662716 ATGTGCTGGTACCTTGATCTTGG - Intergenic
928011763 2:27615525-27615547 CTGTGCAGCTGCATTTATCTGGG + Intronic
928035541 2:27819178-27819200 CTTTGCCAGTACCTTGATCTTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928936438 2:36683849-36683871 ATCTGCAGGCACCTTGATCTTGG - Intergenic
929072025 2:38040522-38040544 ATCTGCTGGTACATTGATCTTGG + Intronic
929936260 2:46296772-46296794 CAGTGCAAGGAAATTGATCTAGG - Intronic
930394008 2:50796888-50796910 CTTTGCTGGTGCCTTGATCTTGG - Intronic
931128043 2:59299244-59299266 CTCTGCTGGCACCTTGATCTTGG + Intergenic
933600428 2:84323724-84323746 TTGTGTAAGTACAGTGATCTGGG + Intergenic
934774887 2:96930951-96930973 ATTTGCTGGTACCTTGATCTTGG + Intronic
934942293 2:98511476-98511498 CTGTGCAGGTATAGAGAGCTGGG + Intronic
935322471 2:101902356-101902378 CCCTGCAGGCACCTTGATCTTGG + Intergenic
936009242 2:108914801-108914823 CTGGGGAGGTACCTTGATTTGGG - Intronic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
936282635 2:111155661-111155683 ATGTGCAGGAACACTGCTCTTGG + Intronic
937029734 2:118728464-118728486 ATCTGCTGGTACCTTGATCTTGG + Intergenic
937134361 2:119540188-119540210 ATGTGCTGGTGCCTTGATCTTGG + Intergenic
937441691 2:121920874-121920896 CCCTGCAGGCACCTTGATCTTGG - Intergenic
938930167 2:136079803-136079825 CTCTGCTGGCACACTGATCTTGG - Intergenic
939383763 2:141469455-141469477 ATCTGCTGGTACCTTGATCTTGG - Intronic
940179848 2:150919602-150919624 TTGTACAGGTATATTCATCTTGG - Intergenic
940298750 2:152157588-152157610 CTCTGCTGGCACTTTGATCTTGG + Intronic
940583607 2:155614024-155614046 CTATGCAGGCACATTAATATAGG - Intergenic
940808510 2:158215961-158215983 CCATGCTGGCACATTGATCTTGG + Intronic
940808560 2:158216693-158216715 CCATGCTGGCACATTGATCTTGG - Intronic
941349846 2:164418696-164418718 ATGTGCTGGTACCTTAATCTTGG - Intergenic
941564802 2:167093615-167093637 CTTTGCAGGGACATGGATCAAGG - Intronic
944502561 2:200377202-200377224 TTGGGCAAGTACTTTGATCTAGG - Intronic
945067789 2:205961728-205961750 CCATGCAGGTACCTTGTTCTTGG - Intergenic
946885255 2:224216516-224216538 CTGACCAGGCACCTTGATCTTGG - Intergenic
948100039 2:235366059-235366081 CTGTGTAGGTACATAGATAATGG - Intergenic
948146723 2:235713803-235713825 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1169302598 20:4457234-4457256 CTTTGCAGGTACATGGATGGAGG + Intergenic
1170040387 20:12034012-12034034 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1170712679 20:18806614-18806636 ATGTGCGGGCACAGTGATCTTGG - Intergenic
1170722772 20:18898387-18898409 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1170829978 20:19831699-19831721 TTGAGCAGGTACAATGAGCTTGG + Intergenic
1171536403 20:25896507-25896529 CTGTGCTGGCACCTAGATCTTGG - Intergenic
1171839353 20:30191775-30191797 CTCTGCAGGCACCTAGATCTTGG - Intergenic
1173173244 20:40744055-40744077 CTGAGCACCTACATTGATCCAGG - Intergenic
1175048152 20:56126710-56126732 ATGTGCAGGCACCTTGCTCTTGG + Intergenic
1175250019 20:57603627-57603649 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1175733246 20:61368457-61368479 ATCTGCAGGCACCTTGATCTTGG + Intronic
1176920589 21:14683453-14683475 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1177203612 21:17985871-17985893 ATCTGCTGGTACCTTGATCTTGG - Intronic
1177421296 21:20861238-20861260 CCCTGCAGGCACCTTGATCTTGG + Intergenic
1177918936 21:27125915-27125937 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1178000252 21:28154071-28154093 ATTTGCCGGTACCTTGATCTTGG + Intergenic
1178057553 21:28816122-28816144 CTGTGCTGGCACCTTGATCTTGG + Intergenic
1178374068 21:32051879-32051901 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1179523261 21:41959171-41959193 CTGTGCAGAGACACTGATCACGG - Intergenic
1181531042 22:23517635-23517657 ATCTGCAGGCACATTCATCTTGG + Intergenic
1184722795 22:46325080-46325102 ATCTGCAGGTGCCTTGATCTTGG - Intronic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
949373024 3:3355423-3355445 ATCTGCTGGTACCTTGATCTTGG + Intergenic
951681099 3:25295432-25295454 ATCTGCTGGTACCTTGATCTTGG + Intronic
954731802 3:52669882-52669904 CTGTGCAGGTCCACTTATATGGG + Intronic
954868080 3:53746557-53746579 CTGTGCCTGTACATTGGTTTGGG + Intronic
954898251 3:53995984-53996006 ATCTGCTGGTACCTTGATCTTGG + Intergenic
956144726 3:66181047-66181069 CCCTGCTGGTACCTTGATCTTGG + Intronic
956393405 3:68799269-68799291 CTCTGCAGACACGTTGATCTTGG - Intronic
957012689 3:75026574-75026596 ATCTGCAGGCACCTTGATCTTGG + Intergenic
957092253 3:75742643-75742665 CTGTCCAGGATCATTCATCTAGG - Intronic
957849441 3:85787648-85787670 CTGTGCAGGATCATTTATATAGG - Intronic
957964367 3:87303736-87303758 CTTTGCAGGGACATGGATGTAGG + Intergenic
959624907 3:108438726-108438748 CTCTGCTGGTACTTTGATCATGG + Intronic
960447663 3:117767217-117767239 ATCTGCAAGTACCTTGATCTTGG + Intergenic
961344771 3:126256864-126256886 CTGTGCGGGCACCCTGATCTTGG - Intergenic
961423862 3:126829752-126829774 ATCTGCTGGCACATTGATCTTGG + Intronic
962288051 3:134105164-134105186 TTTTGCAGGCACATTGTTCTTGG - Intronic
962685461 3:137843288-137843310 ATCTGCTGGTACCTTGATCTTGG + Intergenic
963006755 3:140733625-140733647 ATCTGCAGGCACCTTGATCTTGG - Intergenic
963850906 3:150209484-150209506 ATCTGCTGGTACCTTGATCTTGG + Intergenic
965048973 3:163619356-163619378 CCGTGCAAGTACCTTGATCTTGG - Intergenic
965635313 3:170774729-170774751 CTGTGGTGGTACATTCATCTAGG + Intronic
966583337 3:181593195-181593217 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
966634021 3:182112155-182112177 CATTGCAGGTGCATTGATGTTGG + Intergenic
967098550 3:186197081-186197103 GAGTGCTGGGACATTGATCTGGG + Intronic
967414466 3:189201096-189201118 ATGTGCTGGTGCCTTGATCTTGG + Intronic
967719617 3:192801680-192801702 ATCTGCAGGCACCTTGATCTTGG + Intronic
967924618 3:194636327-194636349 ATCTGCAGGCACCTTGATCTCGG + Intergenic
968265198 3:197357277-197357299 CTCTGCAGGCACCTAGATCTCGG + Intergenic
969090016 4:4686725-4686747 CTGTGCTGACACCTTGATCTTGG - Intergenic
969197211 4:5572568-5572590 ATCTGCAGGTACCTTGATTTCGG + Intronic
969283484 4:6187644-6187666 ATCTGCCGGTACCTTGATCTTGG + Intronic
969886509 4:10220108-10220130 GTGTGCAGCTGCACTGATCTTGG - Intergenic
970317014 4:14838888-14838910 CCCTGCCGGCACATTGATCTTGG + Intergenic
970343061 4:15127062-15127084 CTGTGCCAGTGCCTTGATCTTGG + Intergenic
970468854 4:16355775-16355797 CCGTGTTGGTACCTTGATCTTGG - Intergenic
970940431 4:21626492-21626514 CCTTGCTGGCACATTGATCTTGG + Intronic
971324629 4:25633912-25633934 ATGTGCTGGCACCTTGATCTTGG - Intergenic
971663579 4:29453079-29453101 CTGTGCAGGTACATGGGTTCTGG - Intergenic
971889551 4:32500772-32500794 CTTTGCTGGCACATTGATCTTGG - Intergenic
974046426 4:56902480-56902502 ATGTACAGGTTCATTAATCTAGG + Intergenic
974116855 4:57589518-57589540 CTCTGCTGGAACCTTGATCTTGG + Intergenic
974154916 4:58059117-58059139 CTTTGCAGGAACATTGATGGAGG - Intergenic
974596588 4:64020718-64020740 CTGTGTAGGGACAATGAACTAGG - Intergenic
975637125 4:76461866-76461888 CTGTGCAGATTTATTCATCTTGG - Intronic
975931194 4:79525198-79525220 ATTTGCTGGTACCTTGATCTTGG - Intergenic
976080934 4:81353996-81354018 ATATGCTGGTACCTTGATCTTGG - Intergenic
976376287 4:84349425-84349447 ATCTGCTGGTACCTTGATCTTGG - Intergenic
976860173 4:89655715-89655737 CCCTGCAGGCACCTTGATCTTGG - Intergenic
977700955 4:100022249-100022271 CAGTGCCAGTACCTTGATCTTGG - Intergenic
977725825 4:100295972-100295994 CTATGCTGGCACCTTGATCTTGG + Intergenic
978781780 4:112563792-112563814 CTGTGCTGGCACCTTGATCTTGG - Intronic
979039970 4:115777231-115777253 CTATGCAGATACATTGATCTTGG + Intergenic
980852184 4:138396265-138396287 CTGTGCTGGCACCCTGATCTTGG + Intergenic
981009049 4:139905657-139905679 CCCTGCAGATACCTTGATCTTGG - Intronic
981009597 4:139911811-139911833 ATGTGCTGGCACCTTGATCTTGG + Intronic
981506684 4:145508787-145508809 CCATCCAGGTACCTTGATCTTGG - Intronic
982165308 4:152608591-152608613 ATCTGCAGGCACTTTGATCTTGG + Intergenic
982319793 4:154066445-154066467 CTGATGGGGTACATTGATCTTGG + Intergenic
982403365 4:154993455-154993477 CTGTGCTGGTACCTTGATCTTGG - Intergenic
982828922 4:160035724-160035746 GTGGGCAGGTACATGAATCTGGG + Intergenic
984719443 4:182956190-182956212 CTGCAAAGGCACATTGATCTGGG + Intergenic
985787872 5:1909201-1909223 CTGTCCAGGCACATGGGTCTTGG + Intergenic
985975016 5:3411914-3411936 CTCTGCTGGTATTTTGATCTTGG - Intergenic
986048245 5:4061898-4061920 CTCTGATGATACATTGATCTTGG + Intergenic
986352007 5:6889085-6889107 CTGTCCAGATACAGTGATCTGGG - Intergenic
986964792 5:13257466-13257488 CTCTGCCGGCACCTTGATCTTGG - Intergenic
987081567 5:14429989-14430011 CTGTGCAGGGACATCGGGCTGGG + Intronic
987229984 5:15884076-15884098 CCTTGCTGGTACTTTGATCTTGG - Intronic
988090739 5:26537752-26537774 CTTTGCTGGTACCTCGATCTTGG - Intergenic
988456642 5:31392798-31392820 ATCTGCAGGGACTTTGATCTTGG + Intergenic
988594512 5:32579678-32579700 ATATGCAGGCACCTTGATCTTGG - Intronic
989138736 5:38181474-38181496 CCCTGCAGGCACCTTGATCTTGG + Intergenic
990111254 5:52327903-52327925 CTGTGCAGGTCCAAGGATTTGGG + Intergenic
990236015 5:53768329-53768351 CTCTGCCGGCACCTTGATCTTGG - Intergenic
990349346 5:54900072-54900094 ATGTGCAGGCACCTTGATCTTGG + Intergenic
990730849 5:58807523-58807545 CTCAGCAGGCACCTTGATCTTGG - Intronic
990949637 5:61286025-61286047 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
991101461 5:62797994-62798016 CTGTGCAGGTCTATAGATGTAGG - Intergenic
991558265 5:67920922-67920944 CTGTGCTGGCACCTTAATCTTGG + Intergenic
992849784 5:80795397-80795419 ATCTGCTGGTACCTTGATCTTGG - Intronic
992984069 5:82209525-82209547 GTGTGTTGGTACCTTGATCTTGG + Intronic
993168718 5:84387985-84388007 ATCTGCTGGTGCATTGATCTTGG + Intergenic
994599598 5:101886399-101886421 CTGTGCCAGTACTTTGATCTTGG - Intergenic
995350296 5:111167226-111167248 ATCTGCAGGCACCTTGATCTTGG + Intergenic
995999416 5:118340949-118340971 GTCTGCTGGTACCTTGATCTTGG + Intergenic
996154822 5:120085610-120085632 CTTTACAGATACATTTATCTGGG - Intergenic
997482984 5:134203454-134203476 CTGTGCTGACACCTTGATCTTGG - Intronic
998802882 5:145888485-145888507 CTGTGCAGGTTACTTGATCTAGG + Intergenic
999081575 5:148849172-148849194 CCCTGCAGGCACCTTGATCTTGG - Intergenic
999725332 5:154432238-154432260 CTCTGCTGGCACCTTGATCTTGG - Intergenic
999865231 5:155693982-155694004 CAATGCTGGTACCTTGATCTTGG + Intergenic
1000421814 5:161046439-161046461 CTGAGCAGGGAGATTGGTCTTGG - Intergenic
1001003425 5:168029067-168029089 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1002005024 5:176225481-176225503 CCGTGCTGGCACCTTGATCTTGG + Intergenic
1002221350 5:177685144-177685166 CCGTGCTGGCACCTTGATCTTGG - Intergenic
1002600144 5:180349652-180349674 CCCTGAAGGTACCTTGATCTGGG + Intronic
1002864180 6:1106943-1106965 ATCTGCAGATACCTTGATCTTGG - Intergenic
1003322033 6:5060381-5060403 CTTTGCAGGTACATTCATGTAGG + Intergenic
1003585065 6:7381387-7381409 CCGTGCTGGCACCTTGATCTTGG + Intronic
1003819113 6:9876187-9876209 CCATGCAGGTACCCTGATCTTGG + Intronic
1004371803 6:15059270-15059292 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1005518264 6:26575007-26575029 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1005766916 6:29020844-29020866 CTTTTCTGGTACATTAATCTTGG + Intergenic
1008099371 6:47374887-47374909 CTGTGCTGGCAAACTGATCTTGG - Intergenic
1009215735 6:60917724-60917746 CCCTGCTGGTACCTTGATCTTGG - Intergenic
1009882804 6:69590531-69590553 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1011968475 6:93190941-93190963 CTCTCCAGGTAGATTGATATGGG + Intergenic
1012357756 6:98337171-98337193 CTCTGCAGGAACCTTGATCTTGG + Intergenic
1012760881 6:103298779-103298801 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1013066939 6:106693111-106693133 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1013414151 6:109909596-109909618 CTATGCTGGCACCTTGATCTTGG + Intergenic
1013764623 6:113560493-113560515 CTCTGCTGATACTTTGATCTTGG - Intergenic
1014303210 6:119709556-119709578 CTGTTAAGGTAAATTTATCTAGG - Intergenic
1014627938 6:123752247-123752269 ATGTGCTGGCACCTTGATCTTGG + Intergenic
1014851125 6:126340714-126340736 CTTTGCAAGTACATTAATCACGG - Intronic
1015091849 6:129367974-129367996 CATTGCTGGTACCTTGATCTTGG - Intronic
1015369267 6:132432960-132432982 CTGTGGAGGTACATGACTCTGGG - Intergenic
1015640444 6:135326360-135326382 CTGTGCTAGCACCTTGATCTTGG + Intronic
1016115047 6:140270620-140270642 CTCTGCTAGTACCTTGATCTTGG + Intergenic
1016327246 6:142916400-142916422 CTGTGCAGCTCCCTTGTTCTTGG + Intronic
1017548925 6:155483063-155483085 CTGAGCACGTCCATTCATCTTGG + Intergenic
1017952337 6:159146570-159146592 CGATGCTGGTACCTTGATCTTGG - Intergenic
1021652351 7:22844563-22844585 CCCTGCTGGTACCTTGATCTTGG - Intergenic
1021694956 7:23267546-23267568 ATGTGCTGGTACCTTGAACTTGG - Intronic
1021740097 7:23678372-23678394 ATGTGTAGCTAAATTGATCTAGG - Intergenic
1022060585 7:26789906-26789928 CTGGGCAGAAACATTGATCCTGG + Intronic
1022388227 7:29921707-29921729 CTGTTAGGGTACATTGACCTTGG - Intronic
1022539975 7:31126243-31126265 CTCTGCAGGCACCTTGATCTTGG + Intergenic
1023385013 7:39647805-39647827 ATGTGCTGGCACCTTGATCTTGG + Intronic
1024441364 7:49422101-49422123 CCCTGCAGGCACCTTGATCTTGG + Intergenic
1027844927 7:83360916-83360938 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1028594062 7:92528917-92528939 CTGTGAAGGTAAAGTGATTTTGG + Exonic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1030866192 7:114704330-114704352 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1030874794 7:114800471-114800493 ATCTGCTGGTACATTGATCTTGG - Intergenic
1031736477 7:125368509-125368531 ATCTGCTGGCACATTGATCTTGG - Intergenic
1031904123 7:127442002-127442024 CTGTGCTGGCACCCTGATCTTGG + Intergenic
1032881301 7:136093352-136093374 ATATGCTGGTACTTTGATCTTGG - Intergenic
1032892424 7:136212835-136212857 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1033013766 7:137650704-137650726 CCACGCTGGTACATTGATCTTGG + Intronic
1033384762 7:140862069-140862091 CTTTGCAGTTACATAGGTCTAGG - Intronic
1036487591 8:9193725-9193747 CCCTGCTGGTACCTTGATCTTGG + Intergenic
1037407449 8:18558084-18558106 CTCTGCTGGCACCTTGATCTTGG + Intronic
1038276669 8:26127132-26127154 CCCTGCAGGCACCTTGATCTTGG - Intergenic
1038888126 8:31688408-31688430 ATCTGCTGGTACCTTGATCTTGG + Intronic
1039627752 8:39072030-39072052 TTCTGCAGGTACCTTTATCTAGG - Intronic
1040982871 8:53263533-53263555 CTATGCTGGCACTTTGATCTTGG - Intergenic
1042350195 8:67769215-67769237 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1042357208 8:67841345-67841367 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1042432086 8:68718621-68718643 CTGTGCATCCACATTGAACTTGG + Intronic
1042659662 8:71140776-71140798 CTTTGCTGGTGCCTTGATCTTGG - Intergenic
1043056237 8:75443192-75443214 ATCTGCTGGTACTTTGATCTTGG + Intronic
1043867844 8:85395900-85395922 ATCTGCTGGTACCTTGATCTTGG - Intronic
1044385835 8:91587375-91587397 ATGTACTGGTACCTTGATCTTGG + Intergenic
1044719131 8:95128952-95128974 TTGTTCTGGTTCATTGATCTTGG - Intergenic
1045366982 8:101485434-101485456 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1046098976 8:109593032-109593054 CTGTGCATGAAGATTTATCTGGG + Intronic
1046381892 8:113461474-113461496 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1047940714 8:129825386-129825408 CCGTGCTGGCACATTGATCTTGG - Intergenic
1048398984 8:134045666-134045688 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1050008931 9:1164979-1165001 CTTTGGAGGTACACTCATCTGGG - Intergenic
1050114080 9:2244963-2244985 CTCTGCTGGCACCTTGATCTTGG + Intergenic
1050149496 9:2605185-2605207 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1051178982 9:14390797-14390819 ATCTGCTGGCACATTGATCTGGG + Intronic
1052142195 9:25001031-25001053 CTGTGCAGGTCCACTAATATGGG - Intergenic
1052505971 9:29355069-29355091 CTTTGCAGGTACATGGATGAAGG - Intergenic
1052623309 9:30943083-30943105 CTTTGCAGGAACATGGATGTAGG + Intergenic
1055218425 9:73896900-73896922 CTTTGCAGGGACATTGATGAAGG - Intergenic
1055492325 9:76818193-76818215 CTCTACAGGTACTTTCATCTTGG + Intronic
1056414034 9:86359186-86359208 CTGTCCAGGTACATTGTCCTGGG + Intergenic
1056588609 9:87945700-87945722 ATCTGCTGGCACATTGATCTTGG + Intergenic
1057030978 9:91775070-91775092 CTGTGCTGGCACCTTGATCTTGG + Intronic
1058404860 9:104661366-104661388 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1058827591 9:108788673-108788695 CTCTGCGGGCACCTTGATCTTGG - Intergenic
1059336626 9:113573156-113573178 CTGTGCAGGTACCTTGACGTAGG + Intronic
1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG + Intergenic
1059628498 9:116093332-116093354 CTGTGTAGGAACATTGTTTTAGG - Intergenic
1060316739 9:122518378-122518400 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1060317822 9:122529459-122529481 CTATGGAGGTTCTTTGATCTAGG + Intergenic
1060500366 9:124149187-124149209 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1061249430 9:129417823-129417845 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1186163989 X:6807267-6807289 CTGTGCAGGTCCCTGGATATCGG - Intergenic
1186578294 X:10790011-10790033 CTGTGCAGGGAAAATGATTTGGG - Intronic
1186987064 X:15028557-15028579 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1187424938 X:19168821-19168843 CCCTGCAGGCACCTTGATCTTGG + Intergenic
1189286398 X:39854976-39854998 CCGTGCTGGTACCCTGATCTCGG + Intergenic
1189526448 X:41827373-41827395 ATCTGCTGGTACCTTGATCTTGG - Intronic
1189569767 X:42284013-42284035 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1189848162 X:45155468-45155490 CAGTACAGGTACCTTGTTCTCGG + Intronic
1190002286 X:46700621-46700643 TCATGCAGGTACACTGATCTTGG + Intronic
1193269351 X:79511078-79511100 CCATGCAGGCACCTTGATCTTGG + Intergenic
1194980164 X:100432336-100432358 GTGTGCTGGTGCCTTGATCTTGG + Intergenic
1195377420 X:104241269-104241291 CTTTTCAGGTACAGTGACCTTGG + Intergenic
1195438448 X:104873144-104873166 CTATGCCAGTACACTGATCTTGG - Intronic
1196315100 X:114213191-114213213 CTGTGTTGGCACCTTGATCTTGG - Intergenic
1196910327 X:120478267-120478289 ATGTGCTGGCACTTTGATCTTGG + Intergenic
1197106160 X:122719103-122719125 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1198180629 X:134204973-134204995 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1198663213 X:138994172-138994194 CTATGCTGGTACCTTGAGCTTGG - Intronic
1198787369 X:140303606-140303628 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1199135267 X:144242954-144242976 CTTTGCAGGGACATGGATGTAGG - Intergenic
1199194698 X:145014349-145014371 CTCTGCTGGCACCTTGATCTTGG - Intergenic
1199234925 X:145480819-145480841 ATGTGCTGGTACCTTGATCTTGG - Intergenic
1199434580 X:147798915-147798937 CTTTGCAGGGACATTGATGAAGG + Intergenic
1199495030 X:148443357-148443379 ATCTGCGGGTCCATTGATCTTGG - Intergenic
1199945440 X:152662353-152662375 CTGTGCTGGCACCTTGATTTTGG - Intergenic
1200932620 Y:8710876-8710898 CTGTGGAGGTGCATTGGTGTTGG - Intergenic
1201481509 Y:14444400-14444422 ATTTGCAGGTACATAGAGCTTGG + Intergenic
1201632795 Y:16088019-16088041 CTGTGCTGGTGCCTTGACCTTGG - Intergenic
1202054133 Y:20811889-20811911 CTATGCAGGTAAAGTAATCTAGG + Intergenic