ID: 1030657849

View in Genome Browser
Species Human (GRCh38)
Location 7:112187619-112187641
Sequence CTCAGAAGCCACCACTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030657846_1030657849 28 Left 1030657846 7:112187568-112187590 CCCAAAAAAGAAATGGCAAGCGA 0: 1
1: 0
2: 2
3: 27
4: 283
Right 1030657849 7:112187619-112187641 CTCAGAAGCCACCACTTCTCAGG No data
1030657847_1030657849 27 Left 1030657847 7:112187569-112187591 CCAAAAAAGAAATGGCAAGCGAA 0: 1
1: 0
2: 0
3: 29
4: 362
Right 1030657849 7:112187619-112187641 CTCAGAAGCCACCACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030657849 Original CRISPR CTCAGAAGCCACCACTTCTC AGG Intronic
No off target data available for this crispr