ID: 1030659685

View in Genome Browser
Species Human (GRCh38)
Location 7:112206213-112206235
Sequence CCCGAGCAGCGCTGCAGTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030659678_1030659685 13 Left 1030659678 7:112206177-112206199 CCGCGCCCCTTCTCCGGCTCACA 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659677_1030659685 14 Left 1030659677 7:112206176-112206198 CCCGCGCCCCTTCTCCGGCTCAC 0: 1
1: 0
2: 0
3: 26
4: 210
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659676_1030659685 15 Left 1030659676 7:112206175-112206197 CCCCGCGCCCCTTCTCCGGCTCA 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659682_1030659685 0 Left 1030659682 7:112206190-112206212 CCGGCTCACAACAATGCACAGTC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659679_1030659685 8 Left 1030659679 7:112206182-112206204 CCCCTTCTCCGGCTCACAACAAT 0: 1
1: 0
2: 1
3: 5
4: 154
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659680_1030659685 7 Left 1030659680 7:112206183-112206205 CCCTTCTCCGGCTCACAACAATG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030659681_1030659685 6 Left 1030659681 7:112206184-112206206 CCTTCTCCGGCTCACAACAATGC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030659685 Original CRISPR CCCGAGCAGCGCTGCAGTGC CGG Exonic
900498534 1:2988028-2988050 CCCGAGCAGCCCTGCAGACGTGG - Intergenic
901242733 1:7704522-7704544 CCCGAGCCGCGCTGGACGGCGGG - Intronic
901438496 1:9263711-9263733 CCTGGGCAGCCCTGCCGTGCTGG + Exonic
901801131 1:11708571-11708593 CTCCAGCAGGGCTGGAGTGCAGG - Intronic
903283506 1:22263459-22263481 CCCCAGCAGCCGTGCAGTCCAGG + Intergenic
906940586 1:50251954-50251976 GCCGAGCAGCGCGGCAGAGGTGG - Intergenic
912573695 1:110644265-110644287 CCCTTGCAGAGCTGCAGTGGAGG - Intergenic
913513190 1:119581062-119581084 CCCGAGCAGTGGTGCAGAGGAGG + Intergenic
917335102 1:173917808-173917830 CCCCAGCAGCCCTGAAGTGGTGG + Intergenic
919419761 1:197355572-197355594 CCAGAGCAGCACTGGTGTGCTGG + Intronic
919756525 1:201069513-201069535 CCAGTGCAGCGCTGCTGAGCAGG + Exonic
924775118 1:247111192-247111214 CGGGAGGAGCGCTTCAGTGCAGG - Exonic
1063285657 10:4684944-4684966 CCAGAGCAGCCCTGAAGAGCAGG + Intergenic
1064179027 10:13099447-13099469 CCCGGGTAGCGCTGCAGGGATGG - Intronic
1064731959 10:18340527-18340549 CTCGAGCAGGGCTGGAGTCCTGG + Intronic
1067443660 10:46327288-46327310 CCAGAGAAGCTCTGCACTGCTGG - Intronic
1067699001 10:48555423-48555445 CCCCACCAGGGCTGCAGAGCTGG + Intronic
1070934890 10:80285554-80285576 CCAGATCAGTGATGCAGTGCTGG - Exonic
1072201666 10:93165461-93165483 ACTGAGCAGCTATGCAGTGCTGG - Intergenic
1075721280 10:124589009-124589031 CCCCAGCAGCGCGGCTGTGAGGG + Intronic
1080008007 11:27429917-27429939 CCCCTGCAGCCCTGCAGGGCAGG + Intronic
1083241578 11:61392591-61392613 CCGGAGCAGCGCGGCGCTGCCGG - Exonic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1084276536 11:68054178-68054200 CCCGAGCAGCCCTGCTGCACAGG - Intronic
1090248692 11:125236279-125236301 CCTGAGCAGGGCTGCAGAGGAGG - Intronic
1090330874 11:125931304-125931326 CCTGAGCTGCTCTGCACTGCTGG + Intergenic
1091133549 11:133167151-133167173 CCCGAGCAGCCTTCCAGCGCCGG - Intronic
1091173024 11:133535128-133535150 CCCGGGCAGCTCTGCAATGTTGG - Intergenic
1092609145 12:10153717-10153739 GGCGTGCAGCGCCGCAGTGCGGG - Intergenic
1092864556 12:12748770-12748792 CCATTGCAGCACTGCAGTGCAGG + Intronic
1096778754 12:53979914-53979936 GCCCAGCAGGGCTGCAGTCCAGG + Intergenic
1098036026 12:66302733-66302755 GCCGAGGAGCTCTGCAGTGGGGG + Exonic
1099228196 12:79993565-79993587 CGCAAGCACCGCTGCAGTCCTGG + Intergenic
1102471930 12:113164117-113164139 CCCGAGCCGCCCAGCACTGCAGG - Exonic
1103323993 12:120108388-120108410 CCCCAGCAGCACTGCAGGGGAGG + Intronic
1103447226 12:121002120-121002142 CCCGAGCAGCTGAGCAGGGCCGG + Exonic
1104420062 12:128627749-128627771 GCAGAGCAGAGCTGCAGGGCGGG - Intronic
1104602502 12:130162842-130162864 CCCGAGCAGGGGTGGAGAGCCGG + Exonic
1113321544 13:109237067-109237089 GCCAAGCAGCTCTGCAGTCCTGG - Intergenic
1113472977 13:110559843-110559865 CAAGAGCTGCCCTGCAGTGCTGG - Intronic
1116928651 14:50668202-50668224 CCCGAGCAGCGTCGCAGAGCGGG - Exonic
1117913022 14:60652451-60652473 CCCGAGCCGCGCTGCAGCGAGGG - Intronic
1118358875 14:65039112-65039134 CCCCAGCAGCTTTTCAGTGCTGG - Intronic
1119786873 14:77320793-77320815 CCCGCGCTCCGCTGCAGTGAAGG - Exonic
1121104712 14:91272785-91272807 CCGGGGCAGGGCTGCAGTGAGGG - Exonic
1121338063 14:93089203-93089225 CCTGAGCAGGCCTGCAGTGAAGG + Intronic
1121352599 14:93185161-93185183 CCCCTGCCGCGCTGCAGCGCCGG - Exonic
1129704283 15:77785574-77785596 CCCGACCAGGGCTCCAGGGCTGG + Intronic
1129878869 15:78994284-78994306 CCAGAGCAGTGCTGCAGGGCTGG - Intronic
1137727962 16:50669824-50669846 CCCAAGCAGAGCTGGAGTGACGG + Intronic
1141694130 16:85611986-85612008 CCAGCGCTGCGCTGCGGTGCGGG - Intronic
1145932865 17:28698429-28698451 CCTGACCACCGCTTCAGTGCGGG - Intronic
1147149943 17:38508924-38508946 CCCAAGCAGCGCTGCTATCCAGG - Intronic
1151692929 17:75698125-75698147 CCAAAGCAGGACTGCAGTGCCGG + Intronic
1152321274 17:79609972-79609994 CTCGAGCAGCGCGGCCGGGCTGG - Intergenic
1155061209 18:22230506-22230528 CCCGGGCAGGGCGGCAGGGCTGG + Intergenic
1155224623 18:23718604-23718626 CCCCCGCAGCCCTGCAGAGCAGG - Intronic
1157047541 18:44120990-44121012 CCCTCCCAGTGCTGCAGTGCTGG + Intergenic
1157513933 18:48297619-48297641 GCTTGGCAGCGCTGCAGTGCCGG + Intronic
1160511191 18:79454467-79454489 CCGCAGCAGGGCTGCATTGCGGG + Intronic
1163677585 19:18663030-18663052 CCCCAGCACCGCAGCATTGCTGG + Intronic
1165255974 19:34577501-34577523 CCCGGGCCGCGCTGCAGCCCCGG - Intergenic
1165291727 19:34891116-34891138 TCCGAGCATAGATGCAGTGCTGG - Intergenic
1166309828 19:41956763-41956785 CCCGAGCAGCAGAGCCGTGCAGG + Exonic
1167048486 19:47065436-47065458 CCGGGGCTGGGCTGCAGTGCAGG + Exonic
1167428445 19:49441487-49441509 CCCGAGCGGAGCTGCGGGGCCGG - Exonic
929460889 2:42101478-42101500 CCCGAGCAGCACGGCGGAGCCGG - Intergenic
929610683 2:43268718-43268740 CCCGAGAAGTTCTGCAGGGCAGG - Intronic
947628050 2:231633409-231633431 CCAGAGCAGCTCAGCAGTGAGGG + Intergenic
949034644 2:241810876-241810898 CCCCAGCACAGCTGCCGTGCAGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1175858729 20:62137652-62137674 CTGGAGCAGCGCTACTGTGCAGG - Intronic
1176030406 20:63008701-63008723 CCCCACCAGCCCTGCAGTTCAGG - Intergenic
1177153949 21:17482662-17482684 CCCGAGGAGCTCTGCAGAGCTGG - Intergenic
1179947206 21:44686462-44686484 ACCGTGCAGCTCTGCTGTGCCGG + Intronic
1180144971 21:45913805-45913827 CCCGAGTTTCGCAGCAGTGCTGG - Intronic
1181048158 22:20226383-20226405 CCCCAGCACAGCAGCAGTGCAGG + Intergenic
1182771905 22:32802163-32802185 CCTAAGCAGCGCTGCAGTCCTGG - Intronic
1184401990 22:44279763-44279785 CCTGAGCACCTCTACAGTGCTGG - Intronic
1184650119 22:45915801-45915823 CCCAGGCAGGGCTGCACTGCTGG + Intergenic
1184887776 22:47356879-47356901 ACCCAGCAGGGCTGCAGTTCAGG + Intergenic
953319146 3:41956353-41956375 CCTGAGCAGCACTGGAGGGCAGG - Intronic
954692453 3:52402882-52402904 CCCGATCAGAGGTGCAATGCTGG - Intronic
955364187 3:58297803-58297825 CCCCAGCAGAGCTTCAGGGCTGG - Intergenic
960046533 3:113204083-113204105 CCCAAGCTGCTCTGCAGTTCTGG - Intergenic
961414695 3:126748800-126748822 CCTGAGCAGGGCTGCAGCCCGGG + Intronic
962364882 3:134772270-134772292 CCCGTGCAGCTGTGCAGGGCTGG + Intronic
968585403 4:1414014-1414036 CCAGAGCGGCCCTGCAGGGCGGG - Intergenic
968597134 4:1491373-1491395 CCCGAGTGCAGCTGCAGTGCTGG + Intergenic
968654240 4:1771773-1771795 CCCGAGCTGCGGTGCAGAACTGG - Intergenic
968775468 4:2537068-2537090 CCCGGGCAGCGCGGCAGGCCTGG + Intronic
969415144 4:7053076-7053098 TGCAGGCAGCGCTGCAGTGCTGG + Intronic
970108333 4:12609821-12609843 CCCGAGGAGCCCTGCCCTGCAGG - Intergenic
973635493 4:52858523-52858545 CCAGAGCAGCACTGCAGAACTGG - Intergenic
975132432 4:70842476-70842498 CCCGAGCTGGGGTGCAGTGGTGG + Intergenic
981366707 4:143912300-143912322 CCCGAGCAGCGTCGCAGAGCGGG - Intergenic
985496924 5:213722-213744 ACCGATCAGCTCTGCATTGCTGG + Intronic
985682310 5:1262872-1262894 CCCAGGCACCTCTGCAGTGCTGG - Intronic
1001512585 5:172334294-172334316 CCCAGGCAGAGCTGCAGAGCTGG - Exonic
1002448724 5:179307171-179307193 CCGGGGCAGCTCTGCAGTGCGGG - Intronic
1002763575 6:219871-219893 CCCGAGCAGCCCTGCAGATATGG + Intergenic
1003618736 6:7678836-7678858 CCCATGCAGCCTTGCAGTGCGGG + Intergenic
1007386911 6:41526473-41526495 CCCAAGCAGGGCTGCAGGGTGGG + Intergenic
1011128729 6:84033683-84033705 CCGGAGCAGGGCTGCAGCGCGGG - Intergenic
1017759536 6:157557137-157557159 TCCGAGCAGCCCGGCAGTTCAGG - Intronic
1019232958 6:170584307-170584329 CGCGAGCAGCCGTGCTGTGCCGG - Exonic
1025122065 7:56313772-56313794 CTCGAACAGAGCTGCAGTGGAGG - Intergenic
1025562032 7:62380877-62380899 CCCGAGCGCTGCAGCAGTGCGGG + Intergenic
1027218997 7:76202162-76202184 CCCGAGCAGAGGGGCAGTGTGGG + Intronic
1029371847 7:100155344-100155366 CCCCAGCAGCCCTGCTGTCCGGG - Exonic
1029823413 7:103166204-103166226 CCCCAGCTTGGCTGCAGTGCAGG + Intergenic
1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG + Exonic
1034491542 7:151395703-151395725 CCAGGGCAGGGCGGCAGTGCAGG + Intronic
1035378467 7:158423271-158423293 CCTGAGCAGCACGGCAGTGAAGG + Intronic
1035382437 7:158448468-158448490 TCTGGGCAGCGCTGCAGTGCAGG + Intronic
1035437293 7:158868553-158868575 ACCGAGCACTGCTGCAGAGCTGG - Intronic
1036221754 8:6926862-6926884 CTGGAGCAGAGCTGCAGGGCTGG - Intergenic
1036226342 8:6960965-6960987 CAAGAGCAGAGCTGCAGGGCTGG - Intergenic
1037772183 8:21808784-21808806 CCCGAGCTGCGTTTCAGTGAAGG + Intronic
1039581686 8:38671947-38671969 CCAGTGCAGCCCTGCAGAGCTGG - Intergenic
1047815889 8:128461887-128461909 CCAGAGCAGGGCTGCAGTAGAGG - Intergenic
1049011782 8:139892195-139892217 CCAGAGCAGCACAGCAGTGCAGG - Intronic
1049205121 8:141360077-141360099 CACCAGCAACGCTGCGGTGCTGG + Intronic
1049790537 8:144470326-144470348 CCTGCGCAGTGCTGCAGTGTGGG - Intronic
1049959786 9:727438-727460 CCCGAGCAGCTCTGGATTACAGG + Intronic
1051780550 9:20684319-20684341 CCCGAGCAGGGGTGCAGCGGTGG - Intronic
1056767695 9:89454995-89455017 GCCCAGCAGCCCTGCAGGGCAGG + Intronic
1056852671 9:90097497-90097519 CCACAGCAGCTCTGCAGAGCTGG - Intergenic
1057873213 9:98733495-98733517 CCCCAGCAGCTCTGCAGAGGTGG - Exonic
1058656064 9:107221547-107221569 GCTCAGCAGGGCTGCAGTGCCGG + Intergenic
1060816466 9:126637996-126638018 CCCGGGCAGGGCTGCGGAGCGGG - Intronic
1062518035 9:136945820-136945842 CCAGAGCAGGGCTGAAGTCCGGG - Intronic
1062583260 9:137237505-137237527 CCCCAACAGGGCTGCAGTTCTGG - Intergenic