ID: 1030660898

View in Genome Browser
Species Human (GRCh38)
Location 7:112218230-112218252
Sequence ATCAGGTAACAATGTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030660894_1030660898 28 Left 1030660894 7:112218179-112218201 CCTATTGGGTCTTGAAACTTTGA 0: 1
1: 0
2: 1
3: 11
4: 118
Right 1030660898 7:112218230-112218252 ATCAGGTAACAATGTACTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030660898 Original CRISPR ATCAGGTAACAATGTACTGG AGG Intronic
901321122 1:8340484-8340506 ATCAGTTCACCATGTACTAGGGG + Intronic
906396745 1:45472761-45472783 ACCAGTTAACAATGTCCAGGAGG + Intronic
913014673 1:114720924-114720946 ATCAGCTAATAAAGTACTGATGG - Intronic
913256130 1:116955598-116955620 ATCAGCTAAGAATGCAATGGTGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914327401 1:146633320-146633342 ATCATATAACATTGTCCTGGAGG + Intergenic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915627242 1:157122375-157122397 ATCAACCAACAATTTACTGGTGG + Exonic
915681793 1:157588715-157588737 ATCAGGTAAAACTGGACAGGAGG + Intronic
919127882 1:193418108-193418130 ACCAGGTCAGAATGTCCTGGTGG - Intergenic
922930231 1:229383076-229383098 ATCAGGCAACATTGTGCTAGTGG + Intergenic
1068199839 10:53768726-53768748 ATCTGGTATCATTGTGCTGGTGG + Intergenic
1070610973 10:77932314-77932336 AGCAGATAACAAGGTACTGGGGG - Intergenic
1071100644 10:82033326-82033348 AAGAGGGAACAATGTACTGTAGG - Intronic
1071115883 10:82219480-82219502 ATCAGGTCACAAAGTACTAAAGG - Intronic
1071611084 10:87031497-87031519 GACAGGTGACAATGTGCTGGGGG - Intergenic
1086602092 11:88645798-88645820 TTCAGGTAACAATGAAAAGGAGG + Intronic
1091690270 12:2591484-2591506 ATCAGTCATCAAGGTACTGGAGG + Intronic
1095528735 12:43159440-43159462 ATTAGGTAACAATGCCCTAGAGG + Intergenic
1101275132 12:103191361-103191383 ATCATGTAATACTGTAATGGTGG + Intergenic
1106187438 13:27421775-27421797 ATCAGGTAACAATGCTCAGGTGG - Intergenic
1113086482 13:106574340-106574362 ATCAGGGAACATTCTTCTGGAGG + Intergenic
1115483260 14:33883587-33883609 CTCAGATAACCATGTACTGGGGG + Intergenic
1115854748 14:37618930-37618952 ATCAGGTACTAATGTACTTCTGG + Intronic
1119943185 14:78663320-78663342 ATCAGGCAAAAATGTTCTGTTGG + Intronic
1120800585 14:88683926-88683948 TACATTTAACAATGTACTGGAGG + Intronic
1127608627 15:60615484-60615506 AGCAGGTAACTCTGTACCGGGGG + Intronic
1128219078 15:65954993-65955015 GTCAGGAAACACTGTTCTGGGGG - Intronic
1133295801 16:4751700-4751722 ATGAGGTCACAGTGTATTGGGGG + Exonic
1135114514 16:19713547-19713569 ATCAGGTCACAATGTGATGGAGG + Intronic
1137777431 16:51067725-51067747 ATGAGCTAACAATGTACTTATGG - Intergenic
1140006159 16:71077620-71077642 ATCATATAACATTGTCCTGGAGG - Intronic
1155367343 18:25061680-25061702 AACAGGTCACATTGTACTTGAGG - Intergenic
1158519692 18:58161613-58161635 ATGAGATTACATTGTACTGGAGG + Intronic
1159531889 18:69665499-69665521 TTCAGATAACAATGGACTGGTGG - Intronic
1162706589 19:12559665-12559687 ACCAGGTAACAAACAACTGGAGG + Intronic
925511544 2:4631663-4631685 AACAAGTAACAATGTACTGGAGG + Intergenic
929664575 2:43823668-43823690 ATGAAGTGACAATGTACTGGTGG - Intronic
930170036 2:48242183-48242205 ACCAGGTAACAATGGAATTGTGG + Intergenic
930892521 2:56407509-56407531 ATAAGGTATCAATGAACTGGGGG + Intergenic
933514611 2:83284460-83284482 AGCTAGTAAAAATGTACTGGAGG - Intergenic
936162412 2:110094616-110094638 ATGAGGTAATACTGTACCGGAGG + Intronic
936182248 2:110276750-110276772 ATGAGGTAATACTGTACCGGAGG - Intergenic
938419989 2:131137606-131137628 ATCAGGAATGAATGAACTGGAGG - Intronic
942845180 2:180415767-180415789 AGCAGGAAACAATGAAGTGGTGG + Intergenic
1168946794 20:1767634-1767656 AACATGTAACAGTGTATTGGGGG + Intergenic
1169950532 20:11038509-11038531 ATTATGTCACAATCTACTGGAGG - Intergenic
1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG + Intronic
1181348241 22:22236309-22236331 AGCAGGTCACAGTCTACTGGTGG + Intergenic
1181764183 22:25079488-25079510 ACCAGGTAAGAAGGTTCTGGAGG + Intronic
1182009739 22:26990409-26990431 TTCAGGTAACAAGGCTCTGGTGG + Intergenic
958421769 3:93938818-93938840 ATCAGGCAACAATGGAGTGTGGG - Intronic
963739498 3:149062047-149062069 ATCACATAACAAATTACTGGTGG - Intronic
965239951 3:166182964-166182986 CTAAGGTAAAAATGTACTGAGGG - Intergenic
966375655 3:179292784-179292806 ATCAGGAGACAATTTAATGGGGG - Intergenic
967110558 3:186289772-186289794 ACCAAGTAACAAAGTACTGAAGG + Intronic
970455687 4:16221426-16221448 ATCATGTAAAAATATGCTGGAGG - Intronic
970580955 4:17473666-17473688 ATGAGGTGACAATGTGCTGATGG + Intronic
970624013 4:17857389-17857411 ACCAGGTAATAATTTTCTGGAGG + Intronic
977414357 4:96712619-96712641 ATAAGGTCACAAGGTAATGGTGG + Intergenic
978263137 4:106787679-106787701 ATAATGTAATAATGTAATGGTGG - Intergenic
981914472 4:150018594-150018616 AACAGTTAACACTGTAATGGAGG + Intergenic
982771546 4:159401413-159401435 ATCAGATATCCATGGACTGGTGG - Intergenic
991338745 5:65581053-65581075 ATCAGTTTACAATGTTTTGGAGG - Intronic
994044413 5:95291832-95291854 ATCAGGAAACTATTAACTGGAGG + Intergenic
994202727 5:96996400-96996422 ATCTGGTAACAATGAAGTGGTGG + Exonic
994398297 5:99247013-99247035 GTCAGGTAATAAGGTACTGGTGG - Intergenic
999902252 5:156096948-156096970 ATCAGGTAAAAATATCCTTGAGG - Intronic
1001724277 5:173883835-173883857 ATCCAATAACAATGCACTGGAGG + Intergenic
1004069544 6:12286087-12286109 ATTAAGTAAAAATGTACAGGTGG + Intergenic
1007005951 6:38362668-38362690 ATAAGGTAGCCATATACTGGTGG + Intronic
1009904870 6:69858300-69858322 ACAAGGTAAGAATGTATTGGAGG - Intergenic
1012256185 6:97035369-97035391 ATAATGTAACACTGTAATGGTGG - Intronic
1014860764 6:126464979-126465001 TTTAGGTAATATTGTACTGGAGG + Intergenic
1015189526 6:130457716-130457738 ATCAGGTTGCTATGAACTGGTGG + Intergenic
1015917000 6:138227685-138227707 ATCATGTGACAATGTCCTGAGGG + Intronic
1017676890 6:156823369-156823391 ATAAGGTCACAGTGTACTCGAGG + Intronic
1018863208 6:167727268-167727290 TTCAGGTACCAATGCAGTGGGGG - Intergenic
1021575451 7:22101882-22101904 CTCAGGTAAACATGCACTGGGGG - Intergenic
1027223603 7:76230330-76230352 ATAAGGTGACACTGTCCTGGTGG - Intronic
1030660898 7:112218230-112218252 ATCAGGTAACAATGTACTGGAGG + Intronic
1031646508 7:124232407-124232429 AGAAGGTAGCACTGTACTGGGGG + Intergenic
1038371548 8:26997780-26997802 ATCACTTCACATTGTACTGGAGG - Intergenic
1042737321 8:72004187-72004209 ATCAGGTGACCAGGTAGTGGTGG - Intronic
1043064882 8:75556509-75556531 ATCAAGTAAAAAAGTATTGGTGG + Intronic
1045675635 8:104605278-104605300 ATCAGATAACTAGTTACTGGTGG + Intronic
1050099426 9:2102734-2102756 GTCATGTAAGAATGGACTGGGGG - Intronic
1186950547 X:14619698-14619720 ATAAGGTAATAAAGTACTGCGGG - Intronic
1188741281 X:33785362-33785384 ATCAGTTAACCAAGTACTGTGGG - Intergenic
1194270710 X:91811167-91811189 AACTGATTACAATGTACTGGAGG + Intronic
1194275422 X:91875129-91875151 ATGAGATAAAAAGGTACTGGAGG - Intronic
1195892113 X:109707258-109707280 AACAGATAGCAATGCACTGGGGG + Intronic
1195934820 X:110114856-110114878 ATAAGATAATAATGTACTTGAGG - Intronic
1196525076 X:116721746-116721768 ATGAGGTAACTATGTAGAGGGGG + Intergenic
1197273468 X:124450713-124450735 ATCAGGTAGCAATGTGCTCAGGG + Intronic
1197284278 X:124577709-124577731 GTGAGGTTACAATGTACTGTAGG + Intronic
1200587942 Y:5032600-5032622 AACTGATTACAATGTACTGGAGG + Intronic
1200592667 Y:5096540-5096562 ATGAGATAAAAAGGTACTGGAGG - Intronic