ID: 1030661476

View in Genome Browser
Species Human (GRCh38)
Location 7:112223671-112223693
Sequence CTGGACAAAAGCGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030661476_1030661483 10 Left 1030661476 7:112223671-112223693 CCCACAAAGGCGCTTTTGTCCAG 0: 1
1: 0
2: 6
3: 15
4: 87
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661476_1030661482 9 Left 1030661476 7:112223671-112223693 CCCACAAAGGCGCTTTTGTCCAG 0: 1
1: 0
2: 6
3: 15
4: 87
Right 1030661482 7:112223703-112223725 CAAAATTTTTTGAGAGAAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 402
1030661476_1030661484 23 Left 1030661476 7:112223671-112223693 CCCACAAAGGCGCTTTTGTCCAG 0: 1
1: 0
2: 6
3: 15
4: 87
Right 1030661484 7:112223717-112223739 AGAAGCAGGGATATAAGCAGAGG 0: 1
1: 0
2: 4
3: 28
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030661476 Original CRISPR CTGGACAAAAGCGCCTTTGT GGG (reversed) Intronic
919139628 1:193554667-193554689 TTGGACAAAAGCACTTTTATGGG + Intergenic
920350026 1:205331762-205331784 CTGAACAAAGGGGCCTTTGGGGG - Intergenic
1065133119 10:22642765-22642787 CTGGACCACAGAGACTTTGTTGG - Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066550278 10:36548263-36548285 CAGGACAAAAGAGGGTTTGTGGG - Intergenic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1085083623 11:73652549-73652571 CGGGACAATGGGGCCTTTGTTGG - Intronic
1087251475 11:95904948-95904970 CTTGACAAAAGCATTTTTGTTGG - Intronic
1093651554 12:21651438-21651460 CTGTACAAAGGGGCCTTAGTGGG + Intronic
1093764502 12:22947386-22947408 CTGGTCACAGGAGCCTTTGTGGG + Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1096043384 12:48540412-48540434 CTGGTCATAAGACCCTTTGTGGG - Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1101816633 12:108150853-108150875 CTGGAAAAAAGGCCCCTTGTTGG + Intronic
1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG + Intronic
1110348414 13:74476443-74476465 TTGTAAAAAATCGCCTTTGTGGG + Intergenic
1113461900 13:110488006-110488028 CAAAACAAAAGCTCCTTTGTGGG - Intronic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG + Intronic
1128338379 15:66803021-66803043 CTGGACCAAAGCACCATGGTGGG + Intergenic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1138297513 16:55899653-55899675 GGGGACAAAAGCACCTTGGTTGG - Intronic
1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG + Intergenic
1141256103 16:82403914-82403936 CAGGACAGAAGCACCTCTGTGGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
932280203 2:70484832-70484854 TTGAACAAAAGCAACTTTGTTGG - Intronic
941141468 2:161788645-161788667 CTGGAGAAATGCCCCTTTGGTGG + Intronic
942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG + Intronic
942491150 2:176490679-176490701 GTGGACAGAAGCGCCGCTGTGGG - Intergenic
1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG + Intergenic
1182872480 22:33660659-33660681 TTGGACACAATCCCCTTTGTTGG + Intronic
1183485075 22:38084204-38084226 CTGGACAAAAGCCTCTTAGCAGG - Intergenic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG + Exonic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
962447577 3:135480925-135480947 CAGGACAAAAGGGCCTGTGAAGG - Intergenic
963471759 3:145750096-145750118 CTGGACAAAAGGTTTTTTGTTGG - Intergenic
964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG + Intronic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
967705348 3:192643370-192643392 TTGGACAAAATCCCCTTTGGTGG - Intronic
968193541 3:196688758-196688780 CTGGACATAGGAGCATTTGTTGG - Intronic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974249889 4:59372074-59372096 CTGGAGCAAAGCTTCTTTGTGGG - Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
985759483 5:1737752-1737774 CAGGAAGAAGGCGCCTTTGTAGG - Intergenic
988035049 5:25817129-25817151 CTGGACAAAAAGGGCTTTCTGGG + Intergenic
989365667 5:40652756-40652778 CTGTACAAAAGAGTCTGTGTGGG - Intergenic
990353105 5:54938672-54938694 CTGGACATGGGGGCCTTTGTAGG - Intergenic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
994729660 5:103476850-103476872 CTAGACAAAAGCATCTTAGTGGG - Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
1001996008 5:176159110-176159132 CAGGTCAAAACCACCTTTGTGGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1010843628 6:80678324-80678346 CTGGACTCAACTGCCTTTGTAGG - Intergenic
1011181421 6:84625905-84625927 CTGGACCAAAAGGCCTTTGGAGG - Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018682583 6:166276108-166276130 TTGGACAACAGAGCCATTGTTGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025130173 7:56370877-56370899 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1025130493 7:56372175-56372197 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1025130812 7:56373469-56373491 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031306786 7:120138555-120138577 CTTAACAAAAGCCCATTTGTTGG + Intergenic
1031380030 7:121074292-121074314 CTGGACAAGAGCCCCTTTTCTGG - Intronic
1033560918 7:142529552-142529574 CTGAACACAACCGCCTTTATTGG + Intergenic
1036942808 8:13067681-13067703 CTAGACAATAGCGTCTTTGAAGG - Intergenic
1037662883 8:20942210-20942232 TTGGACCAAAGTGCCTTGGTTGG - Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1057407174 9:94783202-94783224 CTGAACACAAGCGCCTCTATAGG - Intronic
1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG + Intergenic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190598805 X:52069300-52069322 CTGGAGGAAAGGGCTTTTGTTGG - Intergenic
1190610019 X:52184773-52184795 CTGGAGGAAAGGGCTTTTGTTGG + Intergenic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1199331708 X:146568118-146568140 CAGGAGAAATGCGCCTTGGTGGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic