ID: 1030661483

View in Genome Browser
Species Human (GRCh38)
Location 7:112223704-112223726
Sequence AAAATTTTTTGAGAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 813}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030661472_1030661483 26 Left 1030661472 7:112223655-112223677 CCTAAATCCCAAGGCTCCCACAA 0: 1
1: 3
2: 8
3: 26
4: 209
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661475_1030661483 18 Left 1030661475 7:112223663-112223685 CCAAGGCTCCCACAAAGGCGCTT 0: 1
1: 1
2: 7
3: 23
4: 123
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661474_1030661483 19 Left 1030661474 7:112223662-112223684 CCCAAGGCTCCCACAAAGGCGCT 0: 1
1: 1
2: 5
3: 21
4: 100
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661476_1030661483 10 Left 1030661476 7:112223671-112223693 CCCACAAAGGCGCTTTTGTCCAG 0: 1
1: 0
2: 6
3: 15
4: 87
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661471_1030661483 30 Left 1030661471 7:112223651-112223673 CCTGCCTAAATCCCAAGGCTCCC 0: 1
1: 1
2: 5
3: 20
4: 184
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661477_1030661483 9 Left 1030661477 7:112223672-112223694 CCACAAAGGCGCTTTTGTCCAGG 0: 1
1: 0
2: 6
3: 11
4: 100
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813
1030661481_1030661483 -9 Left 1030661481 7:112223690-112223712 CCAGGGATGGCTGCAAAATTTTT 0: 1
1: 0
2: 6
3: 30
4: 216
Right 1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG 0: 1
1: 0
2: 7
3: 74
4: 813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030661483 Original CRISPR AAAATTTTTTGAGAGAAGCA GGG Intronic
901381075 1:8874764-8874786 AAAATTTTTAAAATGAAGCACGG + Intronic
901888517 1:12241438-12241460 AAAATTGTTTGCGAGACACAAGG - Intronic
902201506 1:14836760-14836782 AAAAATTTTAAAGAGAGGCAAGG - Intronic
903433624 1:23328944-23328966 TAAATTTTTTTATAGAGGCAGGG - Intronic
903932806 1:26873409-26873431 AATATTTGTTGAAAGAAGGAAGG + Intergenic
904238070 1:29126602-29126624 AAAATTTTTTTAAAGAAGCTGGG + Intergenic
904692583 1:32304882-32304904 AAAATTTTTTTGTAGAAACAGGG + Intronic
904923098 1:34024123-34024145 AAAATGTTGGGAGAGAAGTAAGG - Intronic
905466351 1:38156738-38156760 AAAATTTTTTGAGAGCTGTTGGG + Intergenic
905633041 1:39529569-39529591 AAAATTTTTTTTAAAAAGCAGGG - Intergenic
905750746 1:40461455-40461477 AAAATTTTGTCAGAGAAATATGG + Intronic
906213812 1:44027459-44027481 AAAACTGTTGGAGAGAATCAGGG - Intronic
906277338 1:44526303-44526325 GAAATATTTTGAGAGAGGGAAGG - Intronic
906394192 1:45446453-45446475 AAAATTTTTTTAGAGACGACAGG - Intronic
906701041 1:47858429-47858451 AAAATTTTTTTGTAGAAACAGGG + Intronic
906815883 1:48878105-48878127 CAGATTTTTTGAGAGTATCAAGG + Intronic
907104512 1:51869917-51869939 AAATTTTTTTAAGAGATGGAGGG + Intronic
907258723 1:53199483-53199505 AAAATTTCTGGAGTGAAGCTGGG - Intronic
907380913 1:54087615-54087637 AAGATATTTTGAGATAAACAAGG - Intronic
908196025 1:61746235-61746257 AAAATTTTTTAAAAGAGGCCAGG - Intronic
908286743 1:62612696-62612718 AAAATTTATTAAGAGATGTATGG + Intronic
908599910 1:65727533-65727555 AGAATATTTTGAGTGAAGAATGG - Intergenic
908865757 1:68547478-68547500 AAAGGTTTGTGGGAGAAGCATGG - Intergenic
908936258 1:69380420-69380442 AAAATTATTTGAGAGAATAAAGG - Intergenic
909046684 1:70719307-70719329 AAAGTTGTTTGAGAAAAGCAAGG - Intergenic
909292154 1:73897218-73897240 AAAAATTTTAAAAAGAAGCAGGG - Intergenic
909759488 1:79270713-79270735 AAAGATCTATGAGAGAAGCACGG - Intergenic
909798014 1:79768312-79768334 AAAATATTTTTAGAGATGAAAGG + Intergenic
910002271 1:82355029-82355051 AAAATTTTTTGGGAGTGGTATGG + Intergenic
910122553 1:83806648-83806670 AAAATTTCTTTACATAAGCAAGG - Intergenic
910579318 1:88804900-88804922 AAAATTTTTTCAAAGCAACAAGG + Exonic
910923316 1:92372746-92372768 AAAATTTTTTTAAAGTAGCCGGG + Intronic
911130985 1:94388137-94388159 AAAATTATTTCAAGGAAGCAAGG + Intergenic
911210313 1:95132072-95132094 AAAAGTTTTTGCTAGAAGCCAGG + Intronic
911405015 1:97426268-97426290 AAAATTCTTTGGGAAAAGAAGGG + Intronic
911648289 1:100358819-100358841 GAATATTTATGAGAGAAGCATGG + Intronic
912280283 1:108305395-108305417 AAAGATCTGTGAGAGAAGCATGG + Intergenic
912287943 1:108388962-108388984 AAAGATCTGTGAGAGAAGCATGG - Intronic
912597717 1:110895977-110895999 AAAATTTTTTGAGAAAATTAGGG - Intronic
913168079 1:116207890-116207912 ATAATTTTTTAAGAGCACCATGG + Intergenic
914007403 1:143744274-143744296 AAAAATTTTTTGTAGAAGCAGGG + Intergenic
914389932 1:147211564-147211586 AACATCTTTATAGAGAAGCATGG + Intronic
914646219 1:149654757-149654779 AAAAATTTTTTGTAGAAGCAGGG + Intergenic
915057347 1:153146270-153146292 AAGCTTTTCTGAGAGAAGGAAGG + Intergenic
915071704 1:153273929-153273951 AAAATTTTTAGAAACAAGCAAGG - Intergenic
916006741 1:160668450-160668472 TAAATTTTTTGGTAGAAACAAGG + Intergenic
916297916 1:163240522-163240544 AAAATTTTTTAAGAGAGAGATGG + Intronic
916332378 1:163631422-163631444 AAAATTTTTTGAGTCAGGCATGG - Intergenic
916371637 1:164102678-164102700 CAATTTTTTTTGGAGAAGCATGG + Intergenic
916817691 1:168369708-168369730 GAAATTTTTTTAAAGAAGGAGGG - Intergenic
916819045 1:168380428-168380450 AAATTTTCATTAGAGAAGCAAGG - Intergenic
916989026 1:170222213-170222235 AAAATTTTTTAAAAGAACAATGG - Intergenic
917664435 1:177210376-177210398 GAAAGATTTTGAGTGAAGCATGG - Intronic
917705288 1:177626745-177626767 AAAATTCTTAGACAGAAACATGG + Intergenic
918587102 1:186200879-186200901 AAAATTTTTATGGAGATGCAAGG - Intergenic
918659043 1:187066465-187066487 AATATTTTGTGAGAAAAACAAGG + Intergenic
918851700 1:189699108-189699130 AAAATTTTTAGAAAGAAACTTGG - Intergenic
919041411 1:192392998-192393020 AAAAATTATTAACAGAAGCAGGG + Intergenic
919355356 1:196515890-196515912 AAAAATCTGTGGGAGAAGCATGG - Intronic
919542067 1:198860274-198860296 GATTTTTTTTGAGAGAAACAGGG + Intergenic
919718395 1:200805062-200805084 AATATTTTTTGAAATAAGCCTGG - Intronic
920015304 1:202902697-202902719 AAAATTTTTTGAGCCAGGCATGG + Intronic
921040952 1:211431594-211431616 AAAAATTTTTAAGAGAAAAAAGG + Intergenic
921143504 1:212328910-212328932 AAAATTTTTTTAAAGAAATATGG - Intronic
921582783 1:216914470-216914492 AAAATTTTTAGAGAGTTGCAGGG - Intronic
921661966 1:217814223-217814245 CAAATTTTTACAAAGAAGCATGG + Intronic
921996050 1:221419414-221419436 AAAATAATTTGAAAGAAGCCCGG + Intergenic
922297716 1:224266185-224266207 AGGCTTTTTTGAGAGAAACAGGG + Intronic
922562457 1:226579150-226579172 CTAATTCTTTGAGAGAAGCATGG + Intronic
922582296 1:226707505-226707527 AAAATTTTAAGAGAAAAACATGG + Intronic
922589298 1:226762156-226762178 AAAGTTTATTGAAAGAAGGAAGG + Intergenic
922626902 1:227056562-227056584 AAAATTTTTTTGTAGAGGCAGGG + Intronic
923380225 1:233410263-233410285 AAAATTCTTTTAGAGAAAGAAGG + Intergenic
923590166 1:235310841-235310863 AAAACTTTTTTGTAGAAGCAGGG + Intronic
923955460 1:239013397-239013419 AAAACATTTTGAGAGCATCAAGG + Intergenic
924075925 1:240336659-240336681 AACATATTTTGAGAAATGCAAGG + Intronic
924191103 1:241553512-241553534 TAAATTTTTTTATAGAAACAGGG - Intronic
924615541 1:245608924-245608946 AAAAATTTTTCATAGAGGCAGGG + Intronic
1063705888 10:8430475-8430497 AAAATTTTTTGGTAGAGACAAGG + Intergenic
1063937292 10:11091349-11091371 GAAATTTTTTGTGAGAAACATGG + Intronic
1064724046 10:18259392-18259414 AAAATTTTTTTATAGAGACAGGG - Intronic
1064757276 10:18582488-18582510 AGAAGTTTATGAGAGAATCAAGG + Intronic
1064891170 10:20175507-20175529 AAACTTTTTTGGTAGAAACAGGG - Intronic
1064921000 10:20518060-20518082 ATAATTTTTTAAGAGAAGCTGGG + Intergenic
1065394489 10:25219347-25219369 AAAATTTGTTGAAAGAGGAAAGG + Intronic
1066294396 10:34041671-34041693 AAAATTTTTTTGTAGAAACAGGG - Intergenic
1066399752 10:35064713-35064735 AAAATTTTTTTGTAGAAACAGGG + Intronic
1066481770 10:35803062-35803084 AAAAGTTAATGAGAGAAGCTAGG - Intergenic
1067312980 10:45132672-45132694 AAAATTTTTTGGTAGAGACAAGG - Intergenic
1067729592 10:48800486-48800508 AAAAATTTGTGAGGGAAGGAGGG + Intronic
1068654582 10:59561662-59561684 AATCTTTTTGGAGAGAAGCTTGG - Intergenic
1068825391 10:61432447-61432469 AAAATTATGTAAGAGAAGAAAGG + Intronic
1068994531 10:63187607-63187629 AAAATTTTTTGGTAGAAACAGGG + Intronic
1070317695 10:75331602-75331624 AAATTTTTTTGAGCCATGCATGG - Intergenic
1070508402 10:77137775-77137797 AAAATTTTTTTAAAAAAGTAGGG - Intronic
1070694895 10:78555068-78555090 AATAATTTTTCAGAAAAGCATGG - Intergenic
1071219643 10:83450133-83450155 AAAAATTTTTGAGAAGAACAAGG + Intergenic
1071318711 10:84429850-84429872 CAAATTTTTTGTGACAAGCAAGG - Intronic
1072690105 10:97567243-97567265 AAAATTTTTTTGTAGAAACAGGG + Intronic
1074038748 10:109767144-109767166 TAAATTTTTTCATAGAAACAGGG - Intergenic
1074610014 10:115012568-115012590 AATATTTTTGGAGATAAGAAGGG + Intergenic
1075237824 10:120747029-120747051 CAAATTTGTTTAGAGATGCATGG - Intergenic
1075285171 10:121178388-121178410 AAAAATGTTTGAGATAATCAAGG - Intergenic
1075488130 10:122844182-122844204 AAAATTTTTTTAGCCAGGCATGG - Intronic
1076823574 10:132955506-132955528 AAAATTCTGTGGCAGAAGCAAGG + Intergenic
1077816315 11:5689036-5689058 AAACTTTTCTTAGAGAAGCAGGG + Intronic
1077925113 11:6673947-6673969 AGAATTTTTTAAGAGAGGAAAGG - Intergenic
1078226202 11:9393756-9393778 AAAATTTTTAGAAAAAAGAAAGG + Intronic
1079034523 11:17010903-17010925 ACAATTTTTTGAGAGACTTAAGG - Intronic
1079245371 11:18748590-18748612 ATAATTTTTGGGGAGATGCATGG + Intronic
1079668553 11:23136496-23136518 AAAGATCTGTGAGAGAAGCATGG + Intergenic
1079674434 11:23207913-23207935 TATATTTTTTAAGAGAAACAGGG - Intergenic
1079762913 11:24354095-24354117 AAACTTATTTGAGAGAATAATGG - Intergenic
1079768144 11:24420786-24420808 ATAACTTTTTGAGAGAGACAGGG - Intergenic
1079968911 11:27012123-27012145 ACTATTTTGTGAGGGAAGCAAGG - Intergenic
1080170661 11:29298119-29298141 CAAAGTTATTGAGGGAAGCAAGG - Intergenic
1081064645 11:38525361-38525383 AAAATTATTTGAGGGAATAATGG + Intergenic
1081081749 11:38749809-38749831 AAAATATTTTGAAGGAAGAAAGG - Intergenic
1081258028 11:40921597-40921619 AAAATTTGTTGAAAAAAACAAGG - Intronic
1081305905 11:41511954-41511976 CAAATTTCTTGATAGAAGGATGG + Intergenic
1081558223 11:44187195-44187217 AAGATTTTTTAAAAGTAGCACGG - Intronic
1082221610 11:49645600-49645622 AACATTAGTTGAAAGAAGCAAGG - Intergenic
1082819452 11:57534692-57534714 AAAATTTTTTTTGTTAAGCAGGG - Intergenic
1082843673 11:57710353-57710375 AAAATTTTTTTATAGACACAAGG - Intronic
1082920576 11:58488138-58488160 AAAATTTATTTAGAAATGCAAGG + Intergenic
1083514801 11:63246910-63246932 AAAAATTGTTCAGAGAAGTATGG + Intronic
1083979940 11:66159129-66159151 AAAATGTTTTCAGAAATGCAGGG + Intronic
1084145601 11:67263616-67263638 AAGGTTTGTTGAGAGAAGGAAGG + Intergenic
1085103984 11:73826190-73826212 AAAATTTTTTTATAGAGACAGGG + Intronic
1085326993 11:75613798-75613820 AAAATTTATGGAGAGAAGGCTGG + Intronic
1085490484 11:76911917-76911939 AAAATTCTTAGAGGGAAGCTGGG + Intronic
1085683890 11:78604144-78604166 AAGATAGTTTGGGAGAAGCAGGG + Intergenic
1085742041 11:79085711-79085733 GAAACTTTTTCAGAGAAGAATGG - Intronic
1086071107 11:82800253-82800275 AAAATTTTTTTATAGAGACAGGG + Intergenic
1086346968 11:85906722-85906744 AAAATTTTTTTAAAGTAGCCAGG + Intronic
1086488789 11:87337471-87337493 AAAAATTTTTGAGTCATGCAAGG + Intergenic
1086627425 11:88973558-88973580 AACATTAGTTGAAAGAAGCAAGG + Intronic
1086638634 11:89123540-89123562 AAAATTTTTTGAGACAAAAAGGG - Intergenic
1086903124 11:92390105-92390127 AAGTTTTGTTGAGAGAAGAAAGG + Intronic
1087447352 11:98271372-98271394 CAAATTTATTGAGAGAACCAAGG - Intergenic
1087502892 11:98981592-98981614 AGAATTTTCTCAGAAAAGCAAGG - Intergenic
1087969866 11:104467045-104467067 AGAACTTTTTAAGGGAAGCAAGG + Intergenic
1088355659 11:108941503-108941525 AAACTTTTCTGAGACAAACATGG - Intergenic
1088515876 11:110632954-110632976 AAAACTTTTTGTCAGAAACATGG - Intronic
1090682257 11:129073815-129073837 AAAATATCTTGAAAGAAGCTGGG + Intronic
1091164589 11:133463762-133463784 AAACTTTTTTTGGAGAACCAAGG - Intronic
1091469688 12:715902-715924 AAAATTTTTTGAGCCAAGGATGG + Intergenic
1091893341 12:4080674-4080696 AATATTTTTTGAGTGGGGCAAGG - Intergenic
1091906388 12:4192862-4192884 AAAATTTTTTTGTAGAGGCAGGG + Intergenic
1092207772 12:6626285-6626307 AAAATTTTTTCATAGAAACGGGG + Intronic
1092323319 12:7502101-7502123 AAAATGTATTGAGAGATGCCAGG - Intronic
1092736794 12:11590479-11590501 ACTATTCTTTGAGAGAACCATGG + Intergenic
1093485303 12:19645876-19645898 AAAATTCTGTAAGAGAAGTAGGG - Intronic
1094015061 12:25854028-25854050 AAAATTTATGGACAGAAGAAGGG - Intergenic
1094117862 12:26937537-26937559 AAGATTTTGTTAGCGAAGCAGGG - Intronic
1094188426 12:27670601-27670623 AAAATTTTTTTGTAGAAACACGG - Intronic
1094337391 12:29375360-29375382 AATATTTATTGAGAAAAGGAAGG + Intronic
1094575545 12:31681847-31681869 AACAATTTTTTATAGAAGCAGGG + Intronic
1094674314 12:32603874-32603896 AGAATTTTTTTATAGAAACAAGG + Intronic
1095459613 12:42428967-42428989 AAAATTATTTAATAAAAGCAAGG - Intronic
1095659476 12:44713704-44713726 GAAATCCTTTGAGATAAGCAAGG - Intronic
1096206915 12:49730365-49730387 AATAATTTTTGAGAGAGTCATGG - Intronic
1096711397 12:53459108-53459130 AAAATAGTTTGAGAGGGGCATGG + Intronic
1096896415 12:54824787-54824809 AAAATTTATGCAGAGAAGGACGG + Intergenic
1097095271 12:56542720-56542742 AAAATTTTTTTGTAGAGGCAGGG + Intronic
1097105931 12:56624660-56624682 AAAATTTCAAGAGAGAAGAAAGG + Intronic
1097667903 12:62502238-62502260 AAAATTTTTTTAAAAAAGCTAGG + Intronic
1098266609 12:68728126-68728148 AAAATTTTTTTAAATTAGCAGGG + Intronic
1098432250 12:70432564-70432586 AAAATTATTGGAGCCAAGCACGG - Exonic
1098544186 12:71693201-71693223 AAAATTTTTTTTTAGAGGCAGGG + Intronic
1098592879 12:72234848-72234870 AAAATTTTTTGAGCAAATTAAGG + Intronic
1098951082 12:76641007-76641029 AAGATTTTTTCAGACAAGCAAGG - Intergenic
1099029225 12:77504482-77504504 AAAGTTGTTTGAGAGAAAAATGG - Intergenic
1099240681 12:80135119-80135141 AAACTGTGTTGAAAGAAGCAAGG - Intergenic
1099254133 12:80294913-80294935 AAAATTTTTTTGTAGAGGCAGGG - Intronic
1099272905 12:80535479-80535501 AAAAGTTTTTGATAGCAGGAAGG + Intronic
1099940739 12:89185113-89185135 AAAATGTTTTCAAAGAATCATGG + Intergenic
1100348625 12:93756633-93756655 AATATTTTTTGAATGAAGAAAGG + Intronic
1100852732 12:98730101-98730123 AAAATTTTTTTAAAAAAGAAAGG + Intronic
1100894528 12:99165532-99165554 CAAATTCATTAAGAGAAGCAAGG + Intronic
1100995760 12:100299058-100299080 AAAATTTTTTTGTAGAAACAAGG - Intronic
1101080705 12:101180706-101180728 AAAATTTTTTTAAAGAAGTCTGG - Intronic
1101683182 12:106989026-106989048 AAATTATATTGAGAGAACCAGGG - Intergenic
1101932502 12:109026051-109026073 AAAATTATTTAAAAGAATCATGG - Intronic
1101980746 12:109405036-109405058 AAAATTTTTTTGTAGAGGCAGGG - Intronic
1102072818 12:110035743-110035765 AAAATTTTTTGGTAGAGGCTAGG - Intronic
1102866458 12:116378809-116378831 AATATTTTTTGAGACAGACAGGG + Intergenic
1103357137 12:120330080-120330102 AAAATTTTTTGGGCCAGGCACGG + Intergenic
1103679639 12:122683110-122683132 AAAATTTTTTGATACAGGCTGGG + Intergenic
1103750718 12:123158428-123158450 AAAATTTTTTTGTAGAGGCAGGG - Intronic
1104388506 12:128371749-128371771 AAAATTTTTTTATAGAGACAGGG + Intronic
1104570491 12:129920752-129920774 ACATTTTTTTGTAAGAAGCATGG - Intergenic
1105381345 13:19890338-19890360 AAAATTTTTTTATAGAGACAGGG + Intergenic
1105559729 13:21479089-21479111 AAAAATTTTTTGGAAAAGCAAGG + Intergenic
1105568995 13:21581916-21581938 AAAATTTTTTAATAAAAGCTTGG + Intronic
1105634696 13:22205897-22205919 AAAATTTGTTTTGAGAAGAAAGG + Intergenic
1105971335 13:25431442-25431464 AAAATCTGTTTAGAGAAGCCGGG - Intronic
1106301435 13:28469645-28469667 AAAATATTCTGACAGAAGCAGGG - Intronic
1106864255 13:33946584-33946606 AAAATATTTTGTGAGAAAAATGG + Intronic
1106913376 13:34486757-34486779 AAAAATTGTTGGGAGCAGCAGGG - Intergenic
1107013020 13:35686332-35686354 AAAATTTTTGGTAAGAAACAGGG + Intergenic
1107033064 13:35873086-35873108 AAAAATTTTAGAGACAAGCCGGG + Intronic
1107257751 13:38449497-38449519 AATATTTTTTGAGAGAGCCAAGG - Intergenic
1108757889 13:53526202-53526224 AAAACTTTTTGAGAAATGTATGG + Intergenic
1109393474 13:61724004-61724026 CTAACTTTTAGAGAGAAGCAAGG + Intergenic
1109397216 13:61775823-61775845 AGTATTTTTTGAAAGAAGAATGG + Intergenic
1109563533 13:64080289-64080311 GAAAGTTTTTGTGAGAAGAAAGG + Intergenic
1109911494 13:68917938-68917960 AAATTTATTTGAGGAAAGCAGGG - Intergenic
1110002737 13:70225417-70225439 AACATTTTTTGACAGAAAAATGG - Intergenic
1110080975 13:71311225-71311247 AAATTTTTTTGAAAGAATAAGGG - Intergenic
1110272621 13:73607811-73607833 AAAATTTTTTGTGAAACGCTTGG - Intergenic
1110403321 13:75119746-75119768 AAGATATCTTGAGAGAAGGAAGG + Intergenic
1110889836 13:80684978-80685000 CTAAATTTTTAAGAGAAGCATGG + Intergenic
1111026463 13:82533705-82533727 AGAATATCTTGAAAGAAGCAAGG + Intergenic
1111181696 13:84676870-84676892 AAAATATTTTTAGAGAATAATGG + Intergenic
1111321109 13:86630293-86630315 AAAATTTGGGGAGAGAGGCAAGG + Intergenic
1111444782 13:88333345-88333367 AAAATATTGTTAGAGAAACATGG - Intergenic
1111492360 13:88997330-88997352 AAAATGTTCAGAGAGGAGCAGGG + Intergenic
1111789918 13:92841667-92841689 AAAATTTTATGAGACAACCCAGG - Intronic
1112664942 13:101558719-101558741 AGAATTTCTTGAGGGAGGCAAGG - Intronic
1113229815 13:108200333-108200355 AAAATTTTTTCAACAAAGCATGG - Intergenic
1114651641 14:24288763-24288785 AAGATATTATGAGGGAAGCATGG - Intergenic
1114669303 14:24400276-24400298 AAAAGCTTGTGAGAGAAGCCAGG - Intronic
1115440268 14:33426371-33426393 TAAATCTCTTCAGAGAAGCAGGG + Intronic
1115596880 14:34917852-34917874 AAAATTTTTTTAGTGAAACAGGG - Intergenic
1115862528 14:37704091-37704113 AAAATTTTTTAATAGAGACAGGG + Intronic
1116146102 14:41071077-41071099 ATAATCATTTGAGAGAAGAAAGG + Intergenic
1116427484 14:44808394-44808416 AATATTTATTGAGAGCAACATGG - Intergenic
1116438365 14:44920903-44920925 AAAAATTTTTGAGATAATCATGG + Intergenic
1116440958 14:44952190-44952212 CATATTTTTTGAGAGAGGAAAGG - Intronic
1117386947 14:55224875-55224897 AAAATTTTGTGAGACAATTAGGG - Intergenic
1117587985 14:57232601-57232623 AAATTTTTTTGATAAAAACAAGG - Intronic
1117947540 14:61044610-61044632 GAAATTTTTTTAGAGCAGAAAGG + Intronic
1117971369 14:61254026-61254048 AATATTTGTTGAAAGAAGAAAGG - Intronic
1118028665 14:61797719-61797741 AATATTTTGTGGGAGAAGAAGGG + Intergenic
1119079246 14:71676391-71676413 CAATTTTTTTAAGAGAAGAAAGG + Intronic
1119675613 14:76551283-76551305 AAAATTTTTTGAGAGCACAGAGG - Intergenic
1119770375 14:77216992-77217014 AAAATTTTTTGATAGAAACAAGG - Intronic
1120432548 14:84437599-84437621 AAAATATTTTGAGGTAACCAAGG + Intergenic
1120934240 14:89877511-89877533 AAAATGGTATTAGAGAAGCAAGG - Intronic
1121069772 14:91007486-91007508 AAGAGCTTTTGAGAGGAGCATGG - Intronic
1121135639 14:91495742-91495764 AAAATTTTTTTATAGAGACAAGG - Intronic
1121296815 14:92833900-92833922 AAAATTGTTTAAGAGACGCTGGG + Intronic
1122587688 14:102820804-102820826 AAAATTTTTTTATAGAGACAGGG + Intronic
1123693714 15:22861521-22861543 AAAACATTTTGAGATAAACAAGG - Intronic
1124016567 15:25881581-25881603 AAAATGTTTTGAGAAAATAATGG + Intergenic
1124421428 15:29526620-29526642 AAAATTTTTTTATAGTAGCCAGG - Intronic
1124803643 15:32859861-32859883 AAAATTTTTTTTGAGAGACAAGG - Intronic
1125025514 15:35025478-35025500 AAAATTTTTTCAGAAAAATAAGG - Intergenic
1125047981 15:35264829-35264851 AAGATGTTCTGAGAGAAGAAAGG + Intronic
1125102926 15:35936097-35936119 AAAGTTTTTTGGGGGAAGGACGG - Intergenic
1125130763 15:36281348-36281370 AAAGTTTTTGGAGGAAAGCAAGG - Intergenic
1125216720 15:37283523-37283545 AAAGCTTCATGAGAGAAGCATGG + Intergenic
1125952283 15:43762866-43762888 AACATTTCTTGAGAGAGCCAAGG - Intronic
1125986210 15:44055165-44055187 AAAGCTTTGTGAGAGAAGCAGGG - Intronic
1126571399 15:50156957-50156979 AAGATTTTTAGAAACAAGCAAGG + Intronic
1126701001 15:51367490-51367512 AAGATTTTATTAGAGAATCAGGG + Intronic
1127262106 15:57334191-57334213 ACATTTTTTTAAAAGAAGCATGG - Intergenic
1127275994 15:57444647-57444669 AGAATTATTTGTGAGAAGAAGGG + Intronic
1127379855 15:58421296-58421318 AAAAATTTTTTATAGAAACAGGG + Intronic
1127532366 15:59856394-59856416 AAAATGTGTTGAGAGAAAAAAGG + Intergenic
1127543180 15:59963473-59963495 AAAATTTTTTGAGATAGACAGGG - Intergenic
1127877998 15:63128422-63128444 AAATTTTTTTTGGAGAAACAGGG - Intronic
1128476698 15:68003502-68003524 AACATTTTTTGGTAGAGGCAAGG + Intergenic
1128530785 15:68446003-68446025 TAAACTTTTTGAGAGAGGGAGGG - Intergenic
1128777309 15:70330690-70330712 AAAATTTTTGGAGAAAACCTAGG - Intergenic
1129040764 15:72684479-72684501 AAAATTTTTTTTCAGAGGCAGGG - Intronic
1129305454 15:74657755-74657777 AGAATTTTTTGAGCAAACCAGGG - Intronic
1129437586 15:75554497-75554519 AAAATTTTTTTGTAGAGGCAGGG + Intronic
1129796863 15:78384355-78384377 AAAATTTTTTTGTAGAGGCAAGG + Intergenic
1130004382 15:80080537-80080559 AAGATATTTTGAGAGAAAGAGGG - Intronic
1130118178 15:81023760-81023782 CACATTTTTTCAGAGAATCAAGG - Intronic
1130636732 15:85629019-85629041 AAAATTTTTTTGGAGAGGCAGGG - Intronic
1130985355 15:88841353-88841375 AAACTTTATTTACAGAAGCAAGG - Intronic
1131302621 15:91212779-91212801 AAAATTTTTTTATAGAGACAGGG - Intronic
1131611074 15:93964617-93964639 CAAATTATTCGAGAGAAACAGGG + Intergenic
1131720598 15:95164462-95164484 AAAATTTTTTGAAAAATGTAAGG + Intergenic
1131768668 15:95710456-95710478 AAATTTTTTTTAAAGGAGCATGG - Intergenic
1131961800 15:97796901-97796923 CAAATTCTATGAAAGAAGCACGG + Intergenic
1133696456 16:8267970-8267992 AAAATTCTTTGAGAAAACCTAGG - Intergenic
1133768291 16:8852959-8852981 AAAATTTATTGGGAGAAAGATGG + Exonic
1134649747 16:15899016-15899038 AAAATGTTTTCATAGAAACAAGG - Intergenic
1135060583 16:19268004-19268026 AACATTTTTTGACCGAATCATGG + Exonic
1135408107 16:22212811-22212833 AAAATTTTTTAAAATAAGCCAGG + Intronic
1136103562 16:28012711-28012733 AAAATTTTTTCATAGAGACACGG - Intronic
1137278003 16:46949997-46950019 ACAATTTATTTACAGAAGCAGGG + Intergenic
1137321551 16:47388433-47388455 GAAAATTTTTGAAAGAAGCAAGG + Intronic
1137662106 16:50216812-50216834 AAAAATTTTTTAAATAAGCAGGG - Intronic
1138085575 16:54130979-54131001 AAAATATTTTTTGAGAAACAAGG + Intergenic
1138228656 16:55322460-55322482 AAAATTTTATGACAGAAAAATGG - Intergenic
1138429366 16:56958762-56958784 AAAATTTTTTGAAATTAGCCAGG + Intergenic
1138835753 16:60432791-60432813 AAAAGTTTTGTAGAGAAGAATGG - Intergenic
1138854028 16:60666236-60666258 AAAATTTCTAGAGAAAAACATGG + Intergenic
1139174162 16:64667263-64667285 AAAATTTTTTGGTAGAGACAAGG - Intergenic
1139825059 16:69750451-69750473 AAAATTTTTTTATAGAGACAGGG - Intronic
1139940287 16:70600761-70600783 AAAAGTATTTGGGAGAAACAGGG + Intronic
1140100844 16:71915205-71915227 AGATTTTTTTGGGAGAAGCAGGG + Intronic
1140276908 16:73517549-73517571 AAATTTATTTGGGAGGAGCAGGG + Intergenic
1140793798 16:78416504-78416526 AAAATTTGGTGAGAGAGGAAAGG + Intronic
1142776240 17:2141614-2141636 AAAATTTTTTTGCAGAGGCAGGG + Intronic
1142843352 17:2651658-2651680 AAAATAATTTAAGAGAAGCAAGG - Intronic
1143959125 17:10699842-10699864 TATTTTTCTTGAGAGAAGCAGGG + Intronic
1144048867 17:11480194-11480216 AAAAAATTTTGAAAGAAGCTAGG - Intronic
1144649988 17:17001457-17001479 GAAATATTGTGAGACAAGCAGGG + Intergenic
1146008069 17:29174346-29174368 AAAATTTTTTAAAAGTAGCTAGG + Intronic
1146303735 17:31713278-31713300 TAAATTTTTTGAAATAAGCAGGG + Intergenic
1146975373 17:37106932-37106954 AAAATTTTCTGAGAAGAGAAAGG - Intronic
1147273883 17:39298544-39298566 AAAATTTTTTTATAGAGTCAGGG - Intronic
1147696429 17:42358241-42358263 AAAATTTTTTTGTAGAGGCAAGG - Intronic
1147903603 17:43807781-43807803 AAAATTTTTTTATAGAGACAGGG - Intronic
1147907927 17:43834874-43834896 AAAAATTTTTAAAAAAAGCATGG + Intergenic
1148407325 17:47427856-47427878 AAAATTTTTTGTCTGAAACATGG - Intronic
1149262931 17:54899299-54899321 AAAATATTTTGCTAGAGGCATGG + Intergenic
1149417060 17:56470481-56470503 AAAATTTTCTGAGACATGAATGG - Intronic
1149620261 17:58039545-58039567 ATAATTTTATGATAGAAGAAAGG + Intergenic
1149730399 17:58940459-58940481 AAAATATTTTCAGTGAAGTAGGG - Intronic
1149840180 17:59956429-59956451 AAAATTTTTGCAGTGAAGAAAGG + Intronic
1150048887 17:61939465-61939487 AAAATTTTTTTTGAGAGACAGGG - Intergenic
1150363882 17:64563779-64563801 AAATTTTTTTTAAAGAGGCAGGG + Intronic
1150544566 17:66141134-66141156 AAAATTTTCTGAGAAAACAAAGG - Intronic
1150701102 17:67447536-67447558 AAAATTTTTTTGTAGAGGCAGGG + Intronic
1152126086 17:78447857-78447879 AAAATGTTTTTAAAGAAACAGGG - Intronic
1152219438 17:79054297-79054319 AAAATATTTAGAAAGAAGTATGG + Intergenic
1152269368 17:79315018-79315040 AAAATTTTTTGAGACGAGCATGG + Intronic
1152493079 17:80650905-80650927 AATACTTTTAGAGAGAAGTAGGG + Intronic
1153242529 18:3043697-3043719 AAAATTTTTTTATAGAGACAGGG - Intergenic
1153860033 18:9193310-9193332 TAAATTTTTTTACAGAAACAAGG + Intronic
1154131896 18:11744380-11744402 ACGATTTTTAGAGAAAAGCAGGG - Intronic
1154146058 18:11867124-11867146 ACAATTATTTGGGGGAAGCAGGG - Intronic
1154474371 18:14741255-14741277 AAAATATTTAGTGAGAAACAAGG - Intronic
1154986125 18:21552807-21552829 TAATTTTTGTGAGAGATGCAAGG - Intronic
1155014103 18:21815173-21815195 AAAATTTTTTTATAGAGACAGGG + Intronic
1155079683 18:22396620-22396642 AAAATTCTTTATGAGCAGCATGG - Intergenic
1155493967 18:26424898-26424920 AAAGTCTTGTGAGATAAGCAAGG + Intergenic
1155843983 18:30682560-30682582 TAAATTTTAAGATAGAAGCAGGG + Intergenic
1155860702 18:30894689-30894711 CAAATTTATTCAGAGAAGTAAGG - Intergenic
1156356390 18:36345597-36345619 AAAATTTTTTAAAAGTAGCTGGG - Intronic
1156564091 18:38163991-38164013 ATAAATTTTAGAGAGAAGCCTGG - Intergenic
1156645826 18:39161460-39161482 TAAATTATTTGAGAGAAAAAAGG - Intergenic
1156652845 18:39246687-39246709 TTAATTTTTTGAAAGATGCAAGG - Intergenic
1156983304 18:43319740-43319762 AAAGATTATTGAGAAAAGCATGG + Intergenic
1157026008 18:43844767-43844789 AAAATATTGTGAAAGAACCAAGG + Intergenic
1158034777 18:53013747-53013769 CATATTTCTTGAGAAAAGCAGGG - Intronic
1158146998 18:54325720-54325742 AAAATTTTTTTAAAGAGACAGGG + Intronic
1158454902 18:57597488-57597510 AAAACATTTTTAGACAAGCAAGG + Intergenic
1158500888 18:58000556-58000578 AAAATTTATTTGGAAAAGCAAGG - Intergenic
1158607450 18:58908193-58908215 AAAATTTTTGGACACAAGCCAGG + Intronic
1158752959 18:60286934-60286956 AAAATCCTTTGAGAGAAAGAAGG + Intergenic
1159286111 18:66354711-66354733 AATATATTTTGAAAGAAGTAAGG - Intergenic
1159661897 18:71107335-71107357 AAAATTTTCTGCAAGAAGAAAGG + Intergenic
1159744407 18:72213208-72213230 AAAATTTTATGAGGCATGCATGG + Intergenic
1159771311 18:72548591-72548613 ATAAGTTTTTAAGAGAAGTATGG + Intronic
1159936304 18:74370584-74370606 AAATTTTTTTAAAAGAAACAAGG - Intergenic
1162604626 19:11697243-11697265 AAAATTTTTTGAGGTAGACACGG + Intergenic
1163254376 19:16146501-16146523 AAAATTTTTTTGTAGAAACAGGG - Intronic
1164090215 19:21944499-21944521 AAAATATTTTGAAATATGCATGG + Intronic
1164835896 19:31354869-31354891 ACAATCTTTGGAGAGAAGTAGGG + Intergenic
1165710682 19:38008730-38008752 AAAATTTTTTGGTAGAGACAGGG + Intronic
1165883357 19:39059106-39059128 GAAATGTTTTGATACAAGCATGG + Intergenic
1166020357 19:40023255-40023277 CAATTTTGTTGAGAGAAGCTAGG + Intergenic
1166197267 19:41215455-41215477 AAAATTTTTTGGAAGACACAGGG + Intergenic
1166496814 19:43309064-43309086 ACAATTTTGTGAGAGTAGCAGGG + Intergenic
1166629740 19:44395522-44395544 AAAATTTTTTGAGATAATCAGGG + Intronic
1166637716 19:44465896-44465918 AAATTTTTTTGAGATAATCAGGG - Intergenic
1167303736 19:48695384-48695406 AAATTTTTTTGAAATAGGCAGGG + Intergenic
925201988 2:1975027-1975049 AAAATTTTTTGGTAGGAGTAAGG - Intronic
925702058 2:6648477-6648499 AAAAGTTATTGGGAGAAGGAAGG + Intergenic
925843853 2:8018374-8018396 AAAATTTTTGGAACAAAGCAAGG + Intergenic
926125420 2:10268844-10268866 AAGATGTTTAGAGAGAAGCGTGG - Intergenic
926193886 2:10749197-10749219 AAAATTTTTTAAAAGAGGCTGGG + Intronic
927273807 2:21243520-21243542 AAAATTTTTGGAAAAAAGCTTGG + Intergenic
928219022 2:29387336-29387358 TGAATTTTTTGAGAAAAACACGG + Intronic
928479041 2:31662490-31662512 TAAATTTTTTGTAAGAAACAAGG + Intergenic
928523413 2:32114234-32114256 AAATTTTTTTTATAGAAACAGGG - Intronic
928945595 2:36769174-36769196 AAAAATCTTTGAAAGAATCAAGG - Intronic
929131078 2:38572537-38572559 AATAGTTTTTGAAAGAATCATGG - Intronic
930083732 2:47477140-47477162 AAAAGTTTTTTAGAGAGACAGGG + Intronic
930292851 2:49517653-49517675 AAACTTCCTTGAGAGAACCAGGG + Intergenic
930344308 2:50159751-50159773 AAAATGTCTTGGGAGAAGGAAGG + Intronic
930509223 2:52324155-52324177 AAAATTTTTTCATAGAGACAGGG + Intergenic
930597641 2:53407529-53407551 AAAATTTTTGGAGTGAGTCAGGG - Intergenic
930794949 2:55379434-55379456 AAAAGGTTTTGAGAAAATCAGGG + Intronic
931112795 2:59130992-59131014 AAAATTTCTAGAAAGAACCACGG + Intergenic
931590572 2:63878736-63878758 AAAATTTTTTTGTAGAGGCAAGG + Intronic
931885071 2:66608343-66608365 AAAATTTTTTAATATAATCATGG - Intergenic
932244354 2:70183980-70184002 AAAATTTTTTGGTAGAGACAGGG + Intronic
932274128 2:70438974-70438996 AAGAATTTTTCAGAAAAGCAAGG + Intergenic
932332104 2:70903675-70903697 AATATTTGTTGACAGAAGGAAGG + Intronic
932964641 2:76457499-76457521 AAAAATTTTTTAAAGAAGTATGG + Intergenic
933187574 2:79295545-79295567 AAAAGTTTGTGAGGGAAGAAGGG - Intronic
933435004 2:82237865-82237887 AAAATTTTTTTTGAGAGACACGG - Intergenic
935003313 2:99043611-99043633 AAAATATCTTGAAAGCAGCAAGG + Intronic
935508343 2:103936665-103936687 AAAACTTTTTGAGAAAAATATGG + Intergenic
936722304 2:115267396-115267418 AAAAATATTTTAGAGTAGCAGGG + Intronic
938251313 2:129817649-129817671 GAAATTTTATGAGGGGAGCAAGG + Intergenic
938419249 2:131130944-131130966 AAAATTTTTTCAAATAAGCTGGG - Intronic
938544016 2:132310975-132310997 AAAATTTTTTGAGATAATCAGGG - Intergenic
938684096 2:133720214-133720236 AAAATGTTAGGAGAGAAGTAGGG - Intergenic
938684999 2:133729544-133729566 AAAGTTTTTAAAGAAAAGCATGG - Intergenic
938791925 2:134684208-134684230 AACATTTGTTAAGAGAATCAGGG - Intronic
939407831 2:141781776-141781798 AAAATTTTCTGAGAGAGCTAGGG + Intronic
939553145 2:143640537-143640559 AAAAGTTTATGAGAGAAAAAGGG + Intronic
940747022 2:157578677-157578699 AAAATATTTTTAAAGAAGGAGGG - Intronic
940820411 2:158348498-158348520 CAAAATTTTTGAGACAATCAGGG + Intronic
941356092 2:164494056-164494078 AAACATTTTTGAGAGAAGAGAGG + Intronic
941438261 2:165499281-165499303 AAAATCTTTTGAGAAACACAAGG - Intronic
941504909 2:166330625-166330647 ACAATTTTTTCAGGGCAGCAGGG + Intronic
941634881 2:167925801-167925823 AAAATGTTTGGATATAAGCAAGG + Intergenic
942029716 2:171947412-171947434 AAAATTTTTTAAAAAAAGCCAGG - Intronic
942104397 2:172618560-172618582 TAAATTATTTTAGAGAATCATGG - Intergenic
942456545 2:176142129-176142151 AAAATTTGGTGAGTGAACCAGGG - Intergenic
942554235 2:177155212-177155234 AAATTTTATTGAGATAAGAATGG - Intergenic
942586419 2:177484269-177484291 AAAACTATTTAAGACAAGCAGGG - Intronic
943050742 2:182910332-182910354 AAAATTCTTTGAGAGATGAGAGG + Intronic
943260023 2:185647732-185647754 AAATTTTTTTGGGAGAGCCAAGG + Intergenic
943336805 2:186625198-186625220 AAAATTTTTTTATAGAAACGGGG - Intronic
944133660 2:196374207-196374229 AAAATTATTTGAGAATATCATGG - Intronic
944271828 2:197792700-197792722 AAAATATTTTGAGGGAAGATTGG + Intergenic
944466968 2:200011536-200011558 ACAATTTGTTGAGAAAAGCTGGG - Intergenic
944485664 2:200202315-200202337 AAAATTTTTTGGGAGTGGTATGG + Intergenic
945906069 2:215594626-215594648 AAAATTTTTTTAGAGAGACACGG - Intergenic
945972967 2:216248043-216248065 AACATTTTTTTAAAAAAGCAAGG - Intergenic
946502189 2:220261381-220261403 TGAATTTTTTCAGAGAAGCTGGG + Intergenic
946589492 2:221228493-221228515 AAAATTTTTTGTCCGGAGCATGG - Intergenic
946769208 2:223071246-223071268 AACATTTTTTGATCGTAGCATGG - Intronic
946834001 2:223754074-223754096 AAACTTTTTTTAGAGAAGTGGGG - Intronic
946878796 2:224157354-224157376 AAAATTTTTTTAAAGAAACAGGG + Intergenic
947474336 2:230429368-230429390 ACAATATTTTGAAAGCAGCAAGG - Intronic
947697615 2:232205175-232205197 AATATTTTTGGATAAAAGCAAGG - Intronic
947775946 2:232709513-232709535 AAAATTTTTTCATAGAGGCCGGG + Intronic
948204267 2:236154260-236154282 GTAACTTTTTGAAAGAAGCAAGG - Intergenic
948686383 2:239672551-239672573 TAAATTTTTTCATAGAAACAAGG + Intergenic
949061325 2:241959516-241959538 AAGATGTTTTGAAACAAGCAGGG - Intergenic
1169097057 20:2911120-2911142 AATATTTATTAATAGAAGCAAGG + Intronic
1169292609 20:4365436-4365458 AAATATTTTTGGCAGAAGCAAGG + Intergenic
1169298166 20:4417873-4417895 AGAATTTTGTGAGATAGGCAAGG - Intergenic
1169620429 20:7500504-7500526 AACATTCTTTGAGATGAGCAAGG - Intergenic
1169680842 20:8211376-8211398 AAGATTTTTCAAGAGAAACATGG - Intronic
1170979961 20:21203090-21203112 AACAATTTTTCAGATAAGCAAGG - Intronic
1171872883 20:30543703-30543725 AAAATTTTTTGAGATAATCAGGG - Intergenic
1173491163 20:43483332-43483354 AAAATTTTTTTAAAAAAGAAAGG - Intergenic
1173491306 20:43484776-43484798 ATAATTTTTTCAGCCAAGCATGG + Intergenic
1173535508 20:43808943-43808965 AAAATTTTTTGGTAGAGGCAGGG + Intergenic
1173729268 20:45317322-45317344 AAAATTGTGTGTGAGAGGCAGGG - Exonic
1173754438 20:45503126-45503148 AAGATTTGTTTAGAGAAACAGGG - Intergenic
1174001284 20:47376677-47376699 AAAATTTTTTCAAACAGGCAGGG - Intergenic
1174697671 20:52576781-52576803 AACATTTTTAGAGACTAGCATGG + Intergenic
1174846876 20:53950916-53950938 AAAATTTATTTATAGAAACAAGG + Intronic
1175882470 20:62268758-62268780 AAAATTTTTTAAAAGTAGCTGGG - Intronic
1176017373 20:62942161-62942183 AAACTTTTTTGGGCCAAGCATGG + Intronic
1177054035 21:16277183-16277205 AACATTTTATAACAGAAGCAGGG + Intergenic
1177334395 21:19704553-19704575 AATATATTTTCAGATAAGCAAGG - Intergenic
1177447276 21:21214089-21214111 GAAATTCATTCAGAGAAGCAAGG - Intronic
1178328158 21:31661974-31661996 AAAATTCTTCAAGAGAAGCTAGG - Intronic
1178809258 21:35866456-35866478 TAAATTTTTTTACAGAAACAGGG - Intronic
1178923379 21:36755222-36755244 AAAATTTTTTTGTAGAGGCAGGG - Intronic
1179055401 21:37927499-37927521 AAAATTTTTTTGTAGAGGCAAGG - Intergenic
1180670909 22:17552209-17552231 AACATTTTTTCAGAACAGCAAGG - Intronic
1180893610 22:19310588-19310610 TAGATTTTTTGAGATAACCATGG + Intergenic
1182390400 22:29989870-29989892 AGAAATTTTTATGAGAAGCAGGG - Intronic
1183204876 22:36411989-36412011 AAAATTTTTTGGTAGAGACAAGG - Intergenic
1184676956 22:46048672-46048694 AAAAAGTTTTGACAGAAGCTGGG - Intergenic
1184829940 22:46978423-46978445 AAAATGTTTAGTGAGAAGAAAGG + Intronic
949478177 3:4468281-4468303 CAAAATTTTTGAGATAATCAGGG + Intergenic
949540752 3:5030429-5030451 CCCATTTTTTGAGAGACGCATGG + Intergenic
949545628 3:5069723-5069745 AAAAGCTATTGAGAGAAGTAAGG - Intergenic
949699551 3:6740742-6740764 GACATTTTGAGAGAGAAGCAGGG - Intergenic
950374693 3:12561445-12561467 AAAATTTCCTGAAAGAACCAGGG - Intronic
950745036 3:15081288-15081310 AGATGTTTTTGAGAGGAGCAAGG + Intronic
950868833 3:16211869-16211891 TTAAATTTTTGAGAGAAACACGG - Intronic
951326809 3:21312867-21312889 AAAATTTTCAGAGTGTAGCATGG + Intergenic
951655909 3:25008255-25008277 AAAAATTATAGAGAGTAGCAGGG - Intergenic
952616337 3:35278108-35278130 AAAGATCTGTGAGAGAAGCATGG - Intergenic
953211897 3:40883489-40883511 AAAAATTTTTGAGATAATCTGGG + Intergenic
953299035 3:41753038-41753060 AAAATGTTTTGATAGAGACAGGG - Intronic
953363217 3:42319197-42319219 AAAATGTTTAGAAACAAGCAAGG + Intergenic
953816749 3:46164058-46164080 AAAAATCTGTGGGAGAAGCATGG + Intronic
953932995 3:47015800-47015822 AAAATTTTTGTAGAGACACAGGG - Intergenic
955220851 3:57022096-57022118 AAAATTTTTTTGTAGAAACAAGG - Intronic
955266992 3:57453934-57453956 AAAATTTTTTTATAGAGACAGGG - Intronic
956037387 3:65109462-65109484 AAAATTTTTTGGTAGAGACAGGG + Intergenic
956165692 3:66396698-66396720 AAGGTATTTTGAGAGAAGGAGGG - Intronic
957164738 3:76657571-76657593 ATATTTTTTTTAGAGAGGCAGGG - Intronic
957210862 3:77256794-77256816 AAAAATTATTGAGAGAAAGACGG - Intronic
957442636 3:80270091-80270113 AAAATATTTTGAGAGGAATATGG + Intergenic
957881885 3:86226267-86226289 AAAACTTTTTGAGAAAAAAATGG + Intergenic
957950813 3:87124139-87124161 AAAAGTATCTGAGAGAAGCAGGG - Intergenic
958006489 3:87818644-87818666 AGCATAATTTGAGAGAAGCAAGG - Intergenic
958726513 3:97911826-97911848 ATGATTTTTTGAGAGAATAAAGG + Intronic
958844881 3:99253970-99253992 AAAATTCAGTGAGAGAAGAAGGG + Intergenic
958922226 3:100120480-100120502 AACATTTTTAGACAGAAGGAAGG - Intronic
959008528 3:101047810-101047832 AAAATTTGTTGAGTTAAGCAAGG + Intergenic
959177637 3:102935918-102935940 AAAATTTTTTAGTAGAGGCAAGG - Intergenic
959195382 3:103173980-103174002 TAAAATTTTTGATAGAGGCAAGG - Intergenic
959196073 3:103184481-103184503 AAAATTATTAGAGAGAATCAAGG - Intergenic
959445605 3:106435376-106435398 AAAATTTTTTAAAAATAGCAGGG + Intergenic
959788186 3:110326806-110326828 AAAAGTCTTGGAGAGGAGCATGG + Intergenic
959793824 3:110397564-110397586 AAAATTTTGGCAGAAAAGCAGGG + Intergenic
960312088 3:116129535-116129557 ACAATGTTTTGAGACAAGCTGGG - Intronic
960336636 3:116425793-116425815 AATGTTTTTTGAGAGGAGGATGG + Intronic
960598368 3:119429460-119429482 AAAATTGTTTGTGGAAAGCATGG - Intergenic
960600555 3:119453812-119453834 TAAATTTGTTTGGAGAAGCAGGG + Intronic
960753944 3:120988670-120988692 AAAATTTTTTTAGAGATGAAAGG + Intronic
960928320 3:122818646-122818668 AAAATCTTGTGAGAGAAACTGGG + Intronic
960941015 3:122934638-122934660 AAAATTTTATAAGACAAGTAGGG + Intronic
961123246 3:124392234-124392256 AAAATTTTTTTATAGATGCTGGG + Intronic
961225422 3:125240602-125240624 AAAATTTTTTAAAATTAGCAGGG + Intronic
961691382 3:128672359-128672381 AAAATTTTTTGGTAGAAACTGGG - Intronic
961766180 3:129212708-129212730 AAAGTTTCTTGAGAGAAAAATGG + Intergenic
962169193 3:133082824-133082846 AAAATTGTTTTATAGAAACAAGG + Intronic
962593208 3:136912824-136912846 AAATTTTTTTTGTAGAAGCAGGG + Intronic
962770442 3:138606380-138606402 AAAATTTTTTTATAGACACAGGG - Intergenic
962984483 3:140522087-140522109 AAAAATCTGTGGGAGAAGCATGG + Intronic
962994744 3:140614673-140614695 AAAATCTTTTTAGACAAGGAAGG + Intergenic
963074035 3:141329954-141329976 TAAATTTTTTTATAGAGGCAAGG - Intronic
963427474 3:145150098-145150120 AAAATTTTAGAAGAGAAACAAGG + Intergenic
963716060 3:148805241-148805263 TAAATTTTTTGAGATAGTCAAGG + Intronic
963736624 3:149024539-149024561 AAAATCTTTTCAGAGGAGAATGG - Intronic
963808428 3:149750144-149750166 AGAATATTGTGAGAGAAGCCAGG + Intronic
963942425 3:151108300-151108322 GATATGTTTTGAGAGAAGTATGG + Intronic
964005674 3:151825011-151825033 AAAAATCTATGACAGAAGCAGGG - Intronic
964078217 3:152718803-152718825 AAATTTTTTAGAGTGAAGCCTGG + Intergenic
964989255 3:162786109-162786131 TAAATATTATGAGAGCAGCATGG + Intergenic
965096897 3:164241044-164241066 AAAAGTTATTGAGAGAAACAAGG + Intergenic
965162048 3:165145933-165145955 AAAATGTTTTGAAAGAATTAGGG - Intergenic
965410599 3:168325997-168326019 AAAATTTTTTTAAAAAGGCAAGG - Intergenic
965828338 3:172753100-172753122 AAAATTTTTTTAGAGAGACAGGG + Intronic
966168784 3:177053294-177053316 AAACTTTATTGAGAAAAACAGGG + Intronic
966295819 3:178421617-178421639 AAATTTTTCAGAGAGAAGAATGG - Intronic
966296932 3:178434829-178434851 GAAATGATTTGAGAGAAGGAGGG + Intronic
966640009 3:182179199-182179221 AAAATTTCCTGAAAGAAGGAGGG - Intergenic
966792857 3:183689686-183689708 AAAATTTTTTGGTAGAGGCAAGG - Intergenic
966825161 3:183958771-183958793 ATATTTTTTGGAGAGAAGCGGGG + Intronic
967503248 3:190223639-190223661 AAAAATCTGTGAGAGAAGCATGG + Intergenic
967748912 3:193091469-193091491 AAAGTTTTCTGAGAAAAGAAAGG + Intergenic
967775806 3:193384724-193384746 AAACTTTTGTGGGAGAAGGAGGG - Intergenic
969380108 4:6789852-6789874 AAAATTTTTTTGTAGAAACAGGG - Intronic
971072642 4:23111950-23111972 GAAATATTTTCAGACAAGCAAGG - Intergenic
971951646 4:33357863-33357885 AAAATTTTTTAATAGAGGCAGGG + Intergenic
972352932 4:38253820-38253842 AAAAGTTTTCTAGAGAAACAGGG + Intergenic
972360277 4:38320139-38320161 TAAATTTTTGCAGAGAAGCCTGG - Intergenic
972435140 4:39026339-39026361 AAAATTTTTTAAGAGAGACAGGG - Intronic
972629493 4:40831101-40831123 AAAATTTTTTTAAAAAAGGATGG + Intronic
972634175 4:40868382-40868404 AAAATTTTTTGAGGAAAAGAGGG + Intronic
972672926 4:41231189-41231211 AAAATTATTTGGAAGAAGGAAGG + Intergenic
972856124 4:43109041-43109063 AAAATTTTTTTAAAAAAGGAAGG + Intergenic
973110022 4:46387212-46387234 AAAACTAGTTGAGAGAAGTATGG + Intronic
973135130 4:46697906-46697928 AAATAATCTTGAGAGAAGCAGGG - Intergenic
973287338 4:48433162-48433184 CAAGTTTTTTGAGGGGAGCAAGG - Intergenic
974210314 4:58764338-58764360 AAAATGTTTTGAAAGAGGAAAGG - Intergenic
974343181 4:60640451-60640473 AAACTGTTTTGAGAAAAACATGG + Intergenic
974451979 4:62075491-62075513 AAAATTTTCTTAGAGAAGAAAGG - Intronic
974516120 4:62913929-62913951 AAAATTATCTGAGAAAAGCTGGG - Intergenic
974713835 4:65640005-65640027 AAAATATGTTGAAAGAAGTAAGG - Intronic
975145031 4:70957612-70957634 AACATTTTTTTAGAGATGGAGGG + Intronic
976030916 4:80752082-80752104 AAAGATCTTTGAGAGAAGCATGG + Intronic
976089113 4:81437057-81437079 AATAGTCTTTCAGAGAAGCAAGG - Intronic
976279228 4:83310509-83310531 AAAATTTTTTTAAAGTAGCCAGG + Intronic
976414626 4:84758418-84758440 AAAATTTTTTGGTAGAGACAAGG + Intronic
976523003 4:86051860-86051882 AAAATCTTTGGAGACAAACATGG + Intronic
976653312 4:87459676-87459698 ATAGATTTTTGAGAAAAGCATGG + Intergenic
976792811 4:88898420-88898442 AAAATTGTTTGAGTCAAGAAGGG + Intronic
976796074 4:88934450-88934472 AAAATTTAGTGAGAAAAGTATGG - Intronic
976836551 4:89381051-89381073 AAAAATTTTTGAAAGAAGGAAGG - Intergenic
977095216 4:92733898-92733920 AAAAATTCTTCAGAGGAGCAGGG + Intronic
977688734 4:99878652-99878674 AATGTTTATTGAGAAAAGCATGG - Exonic
977750489 4:100603954-100603976 ATATTTTTTTAAGAAAAGCAAGG - Intronic
978114590 4:105004087-105004109 AAAATTTTTAGACAAATGCATGG + Intergenic
978780165 4:112543857-112543879 AAATTTTTTTGGTAGAGGCAGGG + Intronic
979101498 4:116621490-116621512 TAAATTTTTTGCTAGAAGCCTGG - Intergenic
979612866 4:122707797-122707819 TAAGTGTTCTGAGAGAAGCAGGG + Intergenic
979621859 4:122806917-122806939 AGAATTTCCTGAGAGAACCAAGG + Intergenic
979801230 4:124912091-124912113 AAAGTTTTTTCTGAGAAGCCTGG + Intergenic
979967831 4:127097010-127097032 AAAATGATTTGAAAGAAGGAAGG + Intergenic
980176727 4:129355016-129355038 AAGATTTCTTGATAGAGGCAGGG + Intergenic
980469924 4:133238222-133238244 AGACTTTTTTGGAAGAAGCAAGG - Intergenic
980546862 4:134275291-134275313 AAAGTTTTGTCAGATAAGCAAGG - Intergenic
980939787 4:139262896-139262918 AAAATTTTTTTATAGAGACAAGG - Intergenic
981341506 4:143626814-143626836 AAAACTGTTGGAGAGAAGCCAGG - Intronic
981495984 4:145393173-145393195 AAAATAATTTGAGACATGCAAGG + Intergenic
981765374 4:148242669-148242691 AATATTTTCTCACAGAAGCAGGG + Intronic
981903177 4:149890287-149890309 ATCATTTTTTAAAAGAAGCATGG + Intergenic
981949987 4:150394317-150394339 AAAATTTTATGACATATGCATGG - Intronic
982202037 4:152970952-152970974 AACATTTTTTGAGTGAAGTGGGG - Intronic
983084239 4:163424742-163424764 GATATTTTCTGAGACAAGCAAGG - Intergenic
983254633 4:165384163-165384185 AATATATTTTGAGAAAAGCTGGG - Intronic
983357258 4:166679657-166679679 CAAATTGTTTGATAGAAGAAGGG - Intergenic
983696088 4:170533438-170533460 AAAAACTCTTGAAAGAAGCAAGG + Intergenic
983838742 4:172427843-172427865 AAATATTTTTGAGAAAAGGAAGG + Intronic
983985495 4:174054700-174054722 TATATATTTTGAGAGAAGAAAGG - Intergenic
985118169 4:186612709-186612731 AAAATTTTTTTAGAGAAAATTGG - Intronic
985125603 4:186691481-186691503 AAAATTTTTTGTTAGAAACAAGG + Intronic
985144816 4:186885706-186885728 TTAATTTTTTTATAGAAGCAGGG + Intergenic
985845914 5:2346854-2346876 AAAGATCTGTGAGAGAAGCATGG + Intergenic
986694806 5:10342226-10342248 AAAATTTTTTTAGCCAGGCATGG - Intergenic
986892374 5:12324612-12324634 CAAATTAGTTAAGAGAAGCAAGG + Intergenic
986939112 5:12928121-12928143 AAAATTTTATGGTAGTAGCAAGG + Intergenic
987024377 5:13909368-13909390 AAAATATTTTGAGAGAGAGAGGG - Intronic
987131126 5:14861082-14861104 TATATTTTTTAAGTGAAGCAAGG + Intronic
987338280 5:16916575-16916597 AAGATTTGATGAGAGCAGCAAGG + Intronic
987697358 5:21349331-21349353 AAAATTTTCTGAAAGAAGTTGGG - Intergenic
987880398 5:23736781-23736803 AAAATATTTTTAGAGAATCAAGG - Intergenic
987922081 5:24296251-24296273 AAAATTTCATCAGAGAAGAAAGG + Intergenic
989301073 5:39894371-39894393 AAATTTTTCTCAGAGAAGGATGG - Intergenic
989693122 5:44169606-44169628 AAAAATCCATGAGAGAAGCATGG - Intergenic
990123271 5:52482742-52482764 AAAACTATTTCAGAGAAGCCAGG + Intergenic
990241803 5:53823506-53823528 GATACTTTTTCAGAGAAGCATGG - Intergenic
990424813 5:55676349-55676371 AAAATTTTTTTATAGAGACAGGG + Intronic
990520547 5:56575125-56575147 AAAATTTTTTTAAAGTAGCCAGG + Intronic
990524326 5:56609986-56610008 AAGATTTTTGGAGAGAACTATGG + Intergenic
990556849 5:56944867-56944889 AAATTTTTTTGGTAGAAACAGGG + Intronic
990633914 5:57701448-57701470 AAAATGTTTTGAGACAATTAGGG - Intergenic
990683295 5:58270150-58270172 AAAAGTTTTTGGGTGGAGCACGG - Intergenic
990937471 5:61165502-61165524 AAAATTTTTTTCTAGAGGCAGGG + Intergenic
991031287 5:62084975-62084997 AAAATATTTTGAGGGAAAGATGG + Intergenic
992093078 5:73336632-73336654 AAAATTCCTTGAGATAAGGATGG + Intergenic
992136001 5:73746113-73746135 AAAATTTTTGGAAAGAAGTTTGG + Intronic
992263826 5:74997430-74997452 AAAAATATTTGAGAAAAGAATGG - Intergenic
992586960 5:78250843-78250865 AAAATATAATGAGAGAAGAAAGG + Intronic
992912501 5:81410700-81410722 AAACTTTTTTGACAGGAGTAGGG + Intergenic
993028850 5:82679806-82679828 AAAATCTTTTGAGAGCAACGGGG + Intergenic
993450646 5:88069333-88069355 AAAGATCTATGAGAGAAGCATGG - Intergenic
993824457 5:92665180-92665202 AAATATTTTTAAGAGAAGAAAGG + Intergenic
993894719 5:93520598-93520620 GAAATTTTTCAAGAGAAGTATGG + Intergenic
994358114 5:98817878-98817900 AAACTTATTTGAGAGAATAATGG + Intergenic
994791922 5:104238476-104238498 ATCATCTTTTGAGAGAAACAAGG + Intergenic
994897113 5:105720964-105720986 AAAGATCTATGAGAGAAGCATGG - Intergenic
994935679 5:106250466-106250488 AGAATTGTGTGAGAGAAGAATGG - Intergenic
994954738 5:106513436-106513458 AAAATTTTTCCAGAGAAATAAGG - Intergenic
995255060 5:110036441-110036463 AACATTTTTTGAAAGAAAGAAGG - Intergenic
995314560 5:110753448-110753470 AGACTGTTTTGAGAAAAGCAAGG + Intronic
996076611 5:119202348-119202370 AAACTTTATTTAAAGAAGCATGG - Intronic
996563860 5:124859024-124859046 AAAAATTTATAAGAGAAGCCTGG - Intergenic
997002396 5:129777178-129777200 AAAATGTTTTCACACAAGCATGG - Intergenic
997482812 5:134201237-134201259 AAAATTTTTGTAGAGACACAGGG - Intronic
997533681 5:134599082-134599104 TAATTTTTTTTATAGAAGCAGGG + Intergenic
998025026 5:138808989-138809011 AAAATTTTTTTAAAGAGACAGGG + Intronic
999184158 5:149693034-149693056 AAAAATTTTTGAGCTAGGCATGG - Intergenic
999213293 5:149909329-149909351 AAAATTTTTTTATAGAGACAGGG + Intronic
999641377 5:153676713-153676735 ATAATTTTTGAAGAGAAGCCAGG - Intronic
1000015847 5:157274946-157274968 AAAATTTTTTTGTAGAAACAGGG + Intronic
1000277028 5:159746992-159747014 ACAATTTTTTGAAAGAAAAATGG - Intergenic
1000849390 5:166321285-166321307 AGAGGTTTTTGAGAGAAGCTGGG - Intergenic
1000881218 5:166700055-166700077 AAAAGGTTTAGAGAGAAGGAAGG + Intergenic
1000938270 5:167329239-167329261 AAAATTTTTAAAGAGAAGGGTGG + Intronic
1002645759 5:180653121-180653143 ACAATTATTAGAGAGAGGCAAGG + Intergenic
1003576400 6:7300301-7300323 AAAACTTTTTGACAGAGGAATGG + Intronic
1004109526 6:12702182-12702204 AAAATTTTTGGATATCAGCAAGG - Intergenic
1004286439 6:14325316-14325338 AAGATTTTTAGAGAGAAGCAGGG - Intergenic
1004743110 6:18482275-18482297 AAAAATTTTTCACACAAGCAAGG - Intergenic
1004758834 6:18643245-18643267 AAAATGTTTTGGAAGTAGCAAGG - Intergenic
1004788214 6:18993166-18993188 AAAATTTTCTGTGAGAAATAGGG - Intergenic
1005034068 6:21539636-21539658 CCAATTTTTTTAGAGAAGAAAGG - Intergenic
1005140551 6:22626682-22626704 AAAAATATTTGAAAGAATCATGG - Intergenic
1005141691 6:22639195-22639217 AAAAATTTTTTAAACAAGCAAGG + Intergenic
1005333826 6:24773878-24773900 AATAATTATTGAGAGAAGCAAGG - Intergenic
1006227948 6:32556426-32556448 ACAATTTTTTGTGAGAAGGAAGG + Intronic
1006381070 6:33697501-33697523 AAACTTTCTTTAGAGCAGCAAGG + Exonic
1006575265 6:35040615-35040637 AAAAGTATTTGAGAAAAACAAGG + Intronic
1006678159 6:35778364-35778386 ATGATTTCTTGAGAGGAGCATGG + Intronic
1006805791 6:36788189-36788211 AAAATTTTTTTAAATTAGCAGGG - Intronic
1007603530 6:43099405-43099427 AAAATTTTTTTATAGAGTCAGGG + Intronic
1007819185 6:44547983-44548005 AAAATTTTTTTATAGAGGTAGGG - Intergenic
1007919291 6:45591724-45591746 AAAGCTCTTTGAGACAAGCACGG - Intronic
1008638806 6:53439785-53439807 AAAAATTTTTGAGTGAATAAAGG + Intergenic
1008656969 6:53625040-53625062 AAAAGTTTATGAGACAATCAGGG + Intergenic
1008866784 6:56221548-56221570 AAAAATTTTTTATAGAGGCAGGG - Intronic
1008916137 6:56789156-56789178 AAATTTTTTTTATAGAAACAGGG - Intronic
1009273301 6:61642986-61643008 AAAATTATTTGGGAGATGCATGG + Intergenic
1009402260 6:63270812-63270834 ACAATTTTTAGAGGGAAGAAAGG + Intergenic
1009519422 6:64662661-64662683 AAAAATCTATGAGCGAAGCAAGG - Intronic
1009661048 6:66611681-66611703 AAATTGTTTTGAGAGCAGTAGGG + Intergenic
1009818336 6:68766930-68766952 ACAATTTTTTTTGAGAACCATGG - Intronic
1010013406 6:71075972-71075994 AACATTTTTAGTGAGAAGCTTGG + Intergenic
1010168875 6:72951186-72951208 ATAATTTTTTGAGGGAAGAGAGG - Intronic
1010250822 6:73705304-73705326 CAAGTCTTTTGAGAGAAGCTTGG + Intronic
1010295905 6:74195182-74195204 AAAAATCTATGAAAGAAGCATGG + Intergenic
1010490125 6:76465974-76465996 AAAATAATTTGAGATAATCAAGG - Intergenic
1010548887 6:77194930-77194952 AAAATTTTTTTAAAAAATCATGG + Intergenic
1010583309 6:77626544-77626566 CAACTCTTTGGAGAGAAGCATGG - Intergenic
1010621378 6:78080497-78080519 AAAATTATTTGTGACAAACAGGG - Intergenic
1010639660 6:78308685-78308707 AAAATTTATTGAAAGAAGCAAGG - Intergenic
1010688774 6:78883095-78883117 AAAATTTTTTTAGAAAATCTGGG + Intronic
1010963942 6:82180847-82180869 AAACTTTTCTGACTGAAGCAAGG - Intronic
1011017314 6:82771333-82771355 TAAATTTTCTGAGAGGATCAAGG + Intergenic
1011971490 6:93229570-93229592 AAAATTTTTTGAGGTAAAGATGG + Intergenic
1012176951 6:96098914-96098936 AAAATTTTATGAGAGCACAAAGG - Intronic
1012387660 6:98700722-98700744 CAAATATTTTGAGAAAAACAAGG + Intergenic
1012414012 6:98992840-98992862 AAACATTTCTGAGTGAAGCAGGG + Intergenic
1012647378 6:101703074-101703096 AATATTTGTTGAGTGAAGGAAGG + Intronic
1012999348 6:106007134-106007156 AAAATTATTTGAGACAGGCCAGG + Intergenic
1013074345 6:106757716-106757738 AATTCTTTTTGAAAGAAGCAAGG - Intergenic
1013120003 6:107132613-107132635 AAAATTTTTTGGTAGAGACAGGG + Intergenic
1013460104 6:110366603-110366625 AAACATTTTTGAGGGAAGGATGG - Intergenic
1013557840 6:111274864-111274886 AAAATTATTTCAGAGAAGATTGG + Intergenic
1014666571 6:124244903-124244925 AAATATTTTTGAGATAACCATGG - Intronic
1014677429 6:124384534-124384556 AAAAATTATTGAGATGAGCAAGG + Intronic
1014982412 6:127960091-127960113 AAGAGTCTTGGAGAGAAGCATGG + Intergenic
1015128837 6:129786866-129786888 AAAATTTTTTTCTAGAGGCAAGG - Intergenic
1015227967 6:130880183-130880205 AAAATTCCTTGAGAGTAGAAGGG - Exonic
1015410134 6:132885054-132885076 AAAATTTTTTGAGACAGGGTTGG - Intergenic
1015488758 6:133800968-133800990 AAAAATTTGTGGGAGAAGCATGG + Intergenic
1015530945 6:134220770-134220792 ATAATTTTTTGATAGAAGCCTGG + Intronic
1015827799 6:137334182-137334204 AAAATATTCAGAGAGAAGCCTGG + Intergenic
1015923761 6:138290217-138290239 ACATTTTTATGAGAGAAGGAAGG + Intronic
1016273585 6:142321127-142321149 AAATGTAATTGAGAGAAGCAGGG + Intronic
1016687092 6:146894306-146894328 AAAATGCTCTGTGAGAAGCAGGG + Intergenic
1016735672 6:147477365-147477387 AATATTTTTTGAGTGAATGAGGG - Intergenic
1016788469 6:148040370-148040392 AAAATATTTTGGGAGATGAAAGG - Intergenic
1017532546 6:155310678-155310700 TAAATTTTTTAAGTGAAGGAAGG - Intronic
1017998282 6:159554076-159554098 AGAATTGTTTGAGGGAAGTAAGG - Intergenic
1018630922 6:165821849-165821871 ATAATTTTTTGATAGACTCATGG + Intronic
1019573122 7:1722887-1722909 AAAATTTTTAAAGAGAAAGAGGG - Intronic
1019813199 7:3180103-3180125 AAAATTTTTTTATAGAGACAGGG - Intergenic
1021116679 7:16753257-16753279 CTTATTTTCTGAGAGAAGCAGGG + Intergenic
1021233901 7:18118985-18119007 AAAATATTCTGAAAGAAGCCAGG - Intronic
1021780203 7:24097609-24097631 AAAATTTCTTGAGACAAACAAGG - Intergenic
1021987703 7:26113230-26113252 AACATTTTTTGACAGATTCAAGG + Intergenic
1022007321 7:26277971-26277993 AAAATTTTTTGAGACAGGGTAGG - Intergenic
1022185014 7:27958815-27958837 AGAATTTTTGGAAAGAAGAATGG + Intronic
1022335420 7:29417222-29417244 AACATTTGTTGAGAAAAGGAAGG + Intronic
1022632126 7:32095187-32095209 AACATTGTTTTTGAGAAGCAAGG - Intronic
1022727911 7:32997385-32997407 AAAATTTTTTTAGAGATGGGGGG + Intronic
1022752668 7:33247122-33247144 AAAATTCTTTCAGAGAAAAATGG - Intronic
1022968743 7:35497952-35497974 AAAATTGTTTTAGAGAAGGAAGG - Intergenic
1023695117 7:42837593-42837615 AGAAATTTTTGAGTGAAGAAAGG - Intergenic
1024524543 7:50336977-50336999 AAAATTTCTAGAAAGAAACATGG + Intronic
1025085330 7:56018961-56018983 AAAATTTTTTTTGAGAGACAGGG - Intronic
1025103725 7:56153874-56153896 AAAATTTTTTTAAAAAAGAAGGG - Intergenic
1025871121 7:65435194-65435216 AAAATTTTTTGAAAAAACCAGGG - Intergenic
1026342195 7:69444232-69444254 ACAATTGTATGATAGAAGCAGGG + Intergenic
1026350309 7:69509851-69509873 AAAATTTTTTGGTAGAGACAGGG - Intergenic
1026712950 7:72758964-72758986 AAAGTTTTCCGAAAGAAGCATGG - Intronic
1027170001 7:75865046-75865068 ATATTTTATTGAGAGAGGCAAGG - Intronic
1027236574 7:76302024-76302046 AATATTTTTTGGTAGAAGTAGGG + Intergenic
1027341471 7:77212816-77212838 AAAATTTTTTTTAAGAAGCTGGG + Intronic
1027370275 7:77502141-77502163 AAAATTTTTTTAAAGTAGCCAGG - Intergenic
1028229579 7:88290585-88290607 AAATTTTTTTGAAAGAGGCCTGG - Intronic
1028451795 7:90993502-90993524 AAATTTTTCTGAAAGAAGAAGGG + Intronic
1028565201 7:92222616-92222638 AAAATGCTTTGAATGAAGCAGGG + Intronic
1028908462 7:96180655-96180677 AAAATGTTTTGGGAGAATCTTGG - Intronic
1029139016 7:98396619-98396641 TGCATTTTTTGATAGAAGCAGGG - Intronic
1029324896 7:99797366-99797388 AAAATTTTAGGAAAGAGGCAGGG + Intergenic
1029794973 7:102884636-102884658 AAAATTTTTTTAAAGAGACAGGG - Intronic
1030358903 7:108574575-108574597 CAAAATTTGTGAGAGAAGGATGG - Exonic
1030624890 7:111833367-111833389 AAAATTTTTTTGTAGAGGCAGGG - Intronic
1030661483 7:112223704-112223726 AAAATTTTTTGAGAGAAGCAGGG + Intronic
1030680029 7:112424708-112424730 AAAATTTTTTGAAACAGGCCTGG - Intronic
1031856781 7:126932515-126932537 AAAATTATTTTATAAAAGCATGG + Intronic
1031915627 7:127560211-127560233 AATATTTATTGACAGAAGAAAGG - Intergenic
1032011365 7:128350319-128350341 AAAATATTTTCAGAGGAGCAAGG - Exonic
1032054602 7:128674295-128674317 AAAAATTTTTGATAGAGACAGGG + Intronic
1032102579 7:128994970-128994992 AAAATTTTTTTATAGAGGTAAGG + Intronic
1032676419 7:134133885-134133907 ATAATTTTTTTATAGAGGCAGGG - Intronic
1032831400 7:135630749-135630771 AAAATTTTTTGGTAGAGACAGGG - Intronic
1034107625 7:148503825-148503847 TAAATATTTTCAGAAAAGCATGG + Intergenic
1034121401 7:148631350-148631372 AAAATTCTTCCAGAGAGGCATGG - Intergenic
1034241155 7:149611974-149611996 AAAATTTTTTAAGACAAACAGGG - Intergenic
1034657262 7:152739581-152739603 AAAATTTTTTTATAGAGACAGGG + Intergenic
1034878607 7:154746786-154746808 AAGATTCATTGAGAGAACCAAGG + Intronic
1035411492 7:158646853-158646875 AAAATTTTGTTAGAGAGGCAGGG - Intronic
1035411611 7:158647855-158647877 AATATTTTTTAATAGAGGCAGGG + Intronic
1035563125 8:622778-622800 AAAATTTTTTTATAGAGACACGG - Intronic
1035849231 8:2897702-2897724 AAAATCTTCTGAGAAAAGCTGGG + Intergenic
1036073460 8:5468129-5468151 AACATGGTTTGAGAGAAGAATGG - Intergenic
1036117476 8:5973591-5973613 TTAATTTTTTGAGGGAAACAGGG - Intergenic
1036529920 8:9575378-9575400 ATAATTTTTTAAGAGGAACAAGG + Intronic
1036929155 8:12936357-12936379 TAAATTTTTTGGTAGAAGCAGGG + Intergenic
1037077131 8:14734056-14734078 AAAATGTTTTGACACAATCACGG + Intronic
1037095817 8:14985476-14985498 AAAAATTTATGAGAAAACCAGGG + Intronic
1037254359 8:16935729-16935751 AAAAAGTTTTGAAAGAAGCCAGG + Intergenic
1037302175 8:17463601-17463623 AAAATTTTTTTGTAGAAACAGGG + Intergenic
1037698705 8:21252040-21252062 AAAATTTTTTTATAGATTCATGG - Intergenic
1038559267 8:28556873-28556895 GAAAATGTTTGAGAGAAGCCTGG + Intronic
1038729940 8:30117818-30117840 AAAAATTTTTTATAGAAACAGGG - Intronic
1039229501 8:35427740-35427762 AAAATTGTTAAAGAGAACCAAGG - Intronic
1039288605 8:36069468-36069490 TAAGTTTTTTGAGAGATGCAGGG - Intergenic
1039647012 8:39297548-39297570 AAAATGTTTTGATACAGGCATGG + Intergenic
1040011901 8:42668345-42668367 ATAATTTTATGAGGGAAGCTGGG + Intergenic
1040366571 8:46723438-46723460 AAAATTTTTTTAAAGAAGAGAGG + Intergenic
1040737907 8:50533389-50533411 AAAATTTTGGGAAACAAGCAAGG + Intronic
1040831009 8:51676876-51676898 AAAATTTTTTCAGACAACCCAGG + Intronic
1040932946 8:52754309-52754331 AAGATTTTTGGATACAAGCAAGG + Intergenic
1041280424 8:56204891-56204913 AAAATATTTTGAGAGAGGAGGGG - Intronic
1041359910 8:57042017-57042039 CAAATTTTTGGAGAGAAACTTGG + Intergenic
1041620809 8:59966363-59966385 ATAAATTTTTGAGAGTAACATGG + Intergenic
1042820551 8:72925429-72925451 AAAATTTTATAAAAGAAGAAAGG + Intronic
1042985050 8:74574168-74574190 AAGATTTTGTGAGAGAGGCAGGG - Intergenic
1043013311 8:74907476-74907498 ACGATTTGTTGAGAAAAGCATGG - Intergenic
1043386635 8:79755427-79755449 AGAAATTTTGAAGAGAAGCATGG - Intergenic
1043635964 8:82382088-82382110 CAAATTTATGGAGAGAAGAAAGG - Intergenic
1043965074 8:86465069-86465091 AAAAACTTTTGAGAGAAAGAAGG + Intronic
1043970104 8:86519065-86519087 AAAAGTTATTAATAGAAGCAGGG - Intronic
1044106152 8:88209850-88209872 AACATTCTTTGAGAGATGAATGG - Intronic
1044388410 8:91618820-91618842 AAGATTTTTTGATGGATGCAAGG - Intergenic
1045748529 8:105454051-105454073 GAAATTTTTTGAGATAAGTAGGG - Intronic
1045832520 8:106480792-106480814 AAACTTTTGTGAGATAGGCAAGG - Intronic
1046009606 8:108530125-108530147 TGTATTTTTTGATAGAAGCAGGG - Intergenic
1046226176 8:111284041-111284063 AAAAATTTTTGAAAGACTCATGG - Intergenic
1046773563 8:118140098-118140120 AAAGTTTTTTGAAAGAATAAGGG - Intergenic
1047075127 8:121392597-121392619 AAAATTTTTTAAAAAAAGAAAGG + Intergenic
1048669359 8:136699367-136699389 ATTATTTTTTGAGACAAGCAAGG + Intergenic
1048710406 8:137203840-137203862 AACATTTTGTGAGAGGAGCCTGG + Intergenic
1049036589 8:140081075-140081097 AAAGTTTTCTCAGAGAAGCAAGG + Intronic
1050835307 9:10070032-10070054 CAAATTTTTGGTGTGAAGCAGGG + Intronic
1051225792 9:14897764-14897786 AAAATTTTTTTGTAGAAACAGGG + Intronic
1051567588 9:18518026-18518048 AATATTTCGTGAGAGAAGGAAGG - Intronic
1051624259 9:19083505-19083527 AAAATTTTTCAAGAGAAGCCGGG + Intronic
1051658577 9:19405942-19405964 ATAATCTGTTGAGAGAAACATGG - Intergenic
1051805871 9:20992002-20992024 AAAAATTTTTGATTAAAGCAGGG + Intronic
1051923225 9:22292231-22292253 AAAATGTTTTGATACAGGCATGG + Intergenic
1052352396 9:27470810-27470832 AATATTTGCTGAGAAAAGCAAGG - Intronic
1053050335 9:34956559-34956581 AAATTTTTTTGAATGAAGGAAGG + Intergenic
1053332404 9:37226091-37226113 AAAATTTTTTGTAAGAAACAAGG + Intronic
1054925337 9:70583212-70583234 AAAATGTCTTGGCAGAAGCAGGG + Intronic
1054987278 9:71277143-71277165 AAAAGTTATTAAGAAAAGCAAGG + Intronic
1055584190 9:77740096-77740118 AAAATATTTTGAGACAATGAAGG - Intronic
1056450779 9:86714758-86714780 AAAAATACTTGGGAGAAGCAAGG - Intergenic
1056641957 9:88379057-88379079 ACAGTTGTTTGAGAGAAGCCTGG + Intergenic
1056712084 9:88999307-88999329 AAAATCTTTGCAAAGAAGCAAGG + Exonic
1057219627 9:93249454-93249476 AAAAGTGTTTTTGAGAAGCATGG - Intronic
1057458825 9:95240265-95240287 AATAGATTTTGAGAGAGGCATGG + Intronic
1057471409 9:95360335-95360357 AACACTTTTTGAGATAATCAGGG - Intergenic
1057585155 9:96322358-96322380 AAAATTTTTTAAAAGTAGCCGGG + Intronic
1057717471 9:97505899-97505921 AAGATCTTTTAAGAGCAGCATGG - Intronic
1057846061 9:98525052-98525074 AAAATTCTTAGAAGGAAGCATGG + Intronic
1057975034 9:99596309-99596331 AAAATTTTTTAACAGAGTCAGGG + Intergenic
1058176696 9:101743554-101743576 TAAATTTTTTTACAGATGCAAGG - Intergenic
1058235278 9:102482619-102482641 ACATTTTTTTGAGAGAAGTGTGG + Intergenic
1058398192 9:104580561-104580583 GAAAATGTTTGAGAGAAGCATGG - Intergenic
1058511471 9:105723550-105723572 AAAAATTTTTAAAAGTAGCAGGG - Intronic
1058689093 9:107504144-107504166 AAAACTTTTTGAAAGTAGCCAGG - Intergenic
1058854742 9:109049962-109049984 AAAATTTTTTTATAGAGACAGGG + Intronic
1059866318 9:118518276-118518298 AAAAATTTTTGATAAAATCATGG + Intergenic
1059945547 9:119405152-119405174 TAAATTTTTGAAGAGAAGAAGGG - Intergenic
1060464584 9:123891808-123891830 AACATTGTTCGAGAGAAGGATGG - Intronic
1060830857 9:126715294-126715316 AAAATTTTTTTGTAGAGGCAGGG - Intergenic
1060860842 9:126953761-126953783 AAAGTTTGTTGAGAGAATGAGGG + Intronic
1062236625 9:135513301-135513323 TAAATGTTTTGAGACAGGCACGG + Intergenic
1062455588 9:136635950-136635972 AAAATTTTTTTATAGAGACAGGG - Intergenic
1186327398 X:8494574-8494596 AAGATATTTTGAGAGAAAGAAGG + Intergenic
1186478138 X:9874902-9874924 AAAATTTTTTGAGAGAGAGATGG - Intronic
1186504949 X:10083627-10083649 AAAATATTTTAAGAGTGGCACGG - Intronic
1186606392 X:11097368-11097390 AAAATTTTGTTACATAAGCAGGG + Intergenic
1186833369 X:13413138-13413160 AAAATGTTTTTAGAGCAGCTGGG + Intergenic
1187296115 X:18002415-18002437 AAAATGTATTTAGAGCAGCAAGG + Intergenic
1188061796 X:25610450-25610472 AAAATCATTTGACAGAAGAAAGG - Intergenic
1188205502 X:27352209-27352231 AAAATTTTTTTCTAGAAACAGGG + Intergenic
1188485322 X:30675678-30675700 AAAATTTTTTTTTAGAAACAAGG + Intronic
1188528413 X:31111367-31111389 AAAAATTTTTCAGAGAAACATGG + Intronic
1188678849 X:32976985-32977007 AAAAGTTTTTAAAAGAAACACGG + Intronic
1188717941 X:33483803-33483825 TAAATTTCATGAGAGAAGCCTGG + Intergenic
1188834423 X:34939115-34939137 AACATTTTAGGAGAGAAGCCTGG - Intergenic
1188919843 X:35959478-35959500 AAAATTCTTAGAGAAAAACATGG - Intronic
1189108500 X:38261663-38261685 AAGACATTTTGAGAAAAGCAAGG + Intronic
1189455313 X:41182449-41182471 AAAATATTCTGAGTGAAGGATGG - Intronic
1189634996 X:42998038-42998060 AAAATATTTTGAGGGAAGAGAGG + Intergenic
1190025707 X:46920950-46920972 AAAATTTTTTTATAGAAACAGGG + Intronic
1190114628 X:47618716-47618738 AAAGCTTTTGGAGAGAAGCTGGG + Intronic
1190721835 X:53155168-53155190 AAAATTTTTTTGTAGAAACAGGG - Intergenic
1191022092 X:55872572-55872594 AAAGTTTTCCCAGAGAAGCAAGG + Intergenic
1191928897 X:66346738-66346760 GGAATTTATTGAGAGAATCATGG - Intergenic
1192039986 X:67609318-67609340 AAACTTTTTTGAGAGGACTATGG - Intronic
1192098268 X:68236285-68236307 CCAATTATTTGAGAAAAGCATGG + Intronic
1192292595 X:69813626-69813648 AATATTTATTGAGAGAGGAAAGG + Intronic
1192920183 X:75698029-75698051 AAATTTTTTTCAGACAAGCAAGG + Intergenic
1193176405 X:78400201-78400223 AAAGATTTGTGACAGAAGCATGG - Intergenic
1193625926 X:83819815-83819837 AAAGATTTGTGGGAGAAGCATGG + Intergenic
1193726461 X:85045385-85045407 AATATTTTCTGAGAAGAGCAAGG - Intronic
1193923723 X:87461195-87461217 AAACATCTTTGAGAGAAGGATGG + Intergenic
1194279622 X:91933112-91933134 AAAATATTTTAAGATAATCAAGG + Intronic
1194440348 X:93925055-93925077 AAATTTATTTGAGAGAAGCTGGG + Intergenic
1194530218 X:95038309-95038331 AAAATTTTTTAAGACATACACGG + Intergenic
1194604889 X:95966206-95966228 AAAGTGAATTGAGAGAAGCATGG - Intergenic
1194820873 X:98505397-98505419 AACATATTTTCAGATAAGCAAGG - Intergenic
1195061172 X:101196416-101196438 AAAATACTTTGAGACAATCAGGG - Intergenic
1195292947 X:103446690-103446712 AAAGTTATTTCAGGGAAGCAGGG - Intergenic
1195845027 X:109217950-109217972 AAACTTTTTTAAATGAAGCATGG + Intergenic
1196303916 X:114078410-114078432 ACCATTTTTTTAGAGAAACATGG - Intergenic
1196350938 X:114728080-114728102 AAATTCTATTGAGAGAAACAAGG + Intronic
1196592517 X:117503816-117503838 AAAATGTTTTGTGATTAGCAAGG + Intergenic
1196663462 X:118293009-118293031 AAAAATTATTGAAAGCAGCAAGG + Intergenic
1196822930 X:119717549-119717571 AAACATTATTGAAAGAAGCACGG + Intergenic
1196935380 X:120725274-120725296 AAGATTTTTAGAAACAAGCAAGG + Intergenic
1197705703 X:129633061-129633083 AAAAGTTATTGAGACAGGCATGG - Intergenic
1198257471 X:134936940-134936962 AAAAATTTTAGAAAGAAGAAAGG - Intergenic
1198408156 X:136337139-136337161 AAAATTTTTTGATAGAGATAGGG + Intronic
1198995662 X:142571217-142571239 AAAGATTTGTGGGAGAAGCATGG - Intergenic
1199369432 X:147029210-147029232 AAAGTTTTTTGAAAGAAGTCAGG - Intergenic
1199369609 X:147031842-147031864 AAAGTTTTTTGAAAGAAGTCAGG - Intergenic
1200161303 X:154011260-154011282 AAAATTTTTTGGCAGAGACAGGG + Exonic
1200597099 Y:5156593-5156615 AAAATATTTTAAGATAATCAAGG + Intronic
1201257104 Y:12119142-12119164 AAAATTTTTTTAAAAAAGCCAGG + Intergenic
1202030687 Y:20571270-20571292 TAAAAGTTTTGAGAGAAGCCAGG + Intergenic
1202133085 Y:21632888-21632910 AAAATTTTTTGAAGGAAGATGGG + Intergenic