ID: 1030661484

View in Genome Browser
Species Human (GRCh38)
Location 7:112223717-112223739
Sequence AGAAGCAGGGATATAAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030661481_1030661484 4 Left 1030661481 7:112223690-112223712 CCAGGGATGGCTGCAAAATTTTT 0: 1
1: 0
2: 6
3: 30
4: 216
Right 1030661484 7:112223717-112223739 AGAAGCAGGGATATAAGCAGAGG 0: 1
1: 0
2: 4
3: 28
4: 355
1030661476_1030661484 23 Left 1030661476 7:112223671-112223693 CCCACAAAGGCGCTTTTGTCCAG 0: 1
1: 0
2: 6
3: 15
4: 87
Right 1030661484 7:112223717-112223739 AGAAGCAGGGATATAAGCAGAGG 0: 1
1: 0
2: 4
3: 28
4: 355
1030661477_1030661484 22 Left 1030661477 7:112223672-112223694 CCACAAAGGCGCTTTTGTCCAGG 0: 1
1: 0
2: 6
3: 11
4: 100
Right 1030661484 7:112223717-112223739 AGAAGCAGGGATATAAGCAGAGG 0: 1
1: 0
2: 4
3: 28
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030661484 Original CRISPR AGAAGCAGGGATATAAGCAG AGG Intronic
901762882 1:11481972-11481994 AGAACCAGTGGTATATGCAGAGG - Intronic
903958097 1:27039091-27039113 AGTCGCAGGGATGAAAGCAGGGG + Intergenic
904342549 1:29846206-29846228 AGAAACATGGAAACAAGCAGGGG - Intergenic
904399598 1:30247504-30247526 GGAAGCATGGAAACAAGCAGGGG + Intergenic
904507252 1:30968057-30968079 AGAATCAGGGATAGATGGAGTGG - Intronic
904911259 1:33936090-33936112 AGAAGCGGGCAGATCAGCAGTGG - Intronic
905766670 1:40607406-40607428 AGGAGCAGGGGTATAAGCCGGGG - Intergenic
905825243 1:41021741-41021763 AGAACCAGGGTTATAGGAAGTGG + Exonic
906065793 1:42979334-42979356 GGAGGCAGGGAGATGAGCAGGGG + Intergenic
906362672 1:45176965-45176987 GGAAGAAGGGATAGTAGCAGTGG - Intronic
906551664 1:46670818-46670840 AGAAGCTGAGCTACAAGCAGTGG + Intronic
906772167 1:48494899-48494921 AGAAGCATGGGTACAAGCAAAGG - Intergenic
907779268 1:57550686-57550708 AGAAGAAGAGACATGAGCAGAGG - Intronic
908211310 1:61903173-61903195 AGGGGCAGGGATGGAAGCAGGGG + Intronic
908634147 1:66143720-66143742 AGAAGTTGAAATATAAGCAGAGG + Intronic
911513676 1:98840491-98840513 GGAAGGAGAGAAATAAGCAGGGG - Intergenic
913069947 1:115289824-115289846 AAAAGCAGAGGGATAAGCAGAGG - Intronic
913201413 1:116497713-116497735 AGATTCAGTCATATAAGCAGAGG - Intergenic
913656466 1:120965067-120965089 AGGAACAGGGATATTAGAAGAGG + Intergenic
914004237 1:143718298-143718320 AAAAGCAGGGAAAGAAGCCGGGG + Intergenic
914007612 1:143746317-143746339 AGGAACAGGGATATTAGAAGAGG + Intergenic
914521017 1:148416296-148416318 AGGAACAGGGATATTAGAAGAGG + Intergenic
914646427 1:149656797-149656819 AGGAACAGGGATATTAGAAGAGG + Intergenic
914832140 1:151178093-151178115 AGAAGCAGGTTCATAAGAAGCGG - Exonic
916186090 1:162134690-162134712 AGAATCAGGGATAGGAGGAGAGG - Intronic
916642939 1:166750777-166750799 AGAAAGAGGGATACAAGAAGGGG + Intergenic
916901524 1:169229389-169229411 AGGAAGAGAGATATAAGCAGGGG - Intronic
918131653 1:181634885-181634907 AGAGGCAGGGTTAGAAGCAGAGG - Intronic
918149213 1:181783523-181783545 AGAAGCAGGGAGAGAAGGACTGG + Intronic
918234698 1:182569503-182569525 AGGAGAAGGGAAATAAGAAGAGG - Intergenic
919782490 1:201229714-201229736 AGAAGCCAGGATCTGAGCAGAGG - Intergenic
921127372 1:212189554-212189576 AGAAGCAGGAAAGGAAGCAGAGG + Intergenic
922903544 1:229156869-229156891 AGAAGGAGAGAAATAAACAGGGG - Intergenic
924406805 1:243756352-243756374 TGAAGCAGGGATATCACAAGCGG + Intronic
924735698 1:246753849-246753871 GGAGGCAGGGTTATAAGGAGGGG + Intronic
1064353210 10:14595870-14595892 AGAAGCAGGGAGACCAGCCGGGG - Intronic
1064893878 10:20211498-20211520 AGAAGCAGGGAAATATTTAGAGG - Intronic
1065818076 10:29500140-29500162 AGGAGCAGCGATGGAAGCAGAGG + Intronic
1067152173 10:43745753-43745775 AGAAGGAGGAATATTAACAGAGG - Intergenic
1067732248 10:48820692-48820714 AGAAGCAGGGAGGGAAGCAGAGG + Intronic
1068597482 10:58918789-58918811 AGCTGCAGTGATCTAAGCAGTGG - Intergenic
1069610474 10:69769343-69769365 AGAAGCTGGGATCTGAGCAAAGG + Intergenic
1070103036 10:73406370-73406392 ATAAGCAAGAATATAAACAGAGG - Intronic
1070440502 10:76438173-76438195 ACATGAGGGGATATAAGCAGCGG + Intronic
1070580066 10:77712317-77712339 AGTAGCAGAGAAAGAAGCAGAGG + Intergenic
1072610830 10:97016901-97016923 AGCAGCAGGGTTTTAAGCTGGGG + Intronic
1075943411 10:126410631-126410653 AGAAGCTGGGCTATAGGCTGAGG - Intergenic
1076563853 10:131385407-131385429 AGGAGCAGAGAGAAAAGCAGAGG + Intergenic
1076564348 10:131387826-131387848 GGAAGCAGGGAAAAAATCAGTGG - Intergenic
1077321628 11:1945492-1945514 AGAAACAGGGATGGAAGGAGTGG + Intergenic
1078846033 11:15119229-15119251 AGAAGCAGGGATTGAAGGGGTGG + Intronic
1078846718 11:15125138-15125160 ATAAGCAGGCATTTAAGCAGAGG + Intronic
1079495636 11:21040471-21040493 AGAGGCAGGAATATAGGCACAGG - Intronic
1080292360 11:30685116-30685138 AGAAGAAGGGGTATAAGCCATGG - Intergenic
1080306265 11:30840134-30840156 AGAAGCAGGGAGAGAAGAGGAGG - Intronic
1080770735 11:35338964-35338986 AGAAGCAGGGACACAACCAACGG + Intronic
1081250251 11:40822292-40822314 AGAAACATGGATAGAAGTAGAGG - Intronic
1082569721 11:54723483-54723505 TGAAGCAGGGGTTGAAGCAGAGG + Intergenic
1083155332 11:60819383-60819405 AGAAGGAGTGATATCAGGAGAGG + Intergenic
1083229616 11:61308001-61308023 GGGAGCAGGGGTAGAAGCAGCGG - Intronic
1084893320 11:72247886-72247908 ACAAGCAGAGATATAAGGGGAGG + Intergenic
1084982525 11:72838301-72838323 AGAAGGAGGGATTTCAGGAGAGG - Exonic
1085227799 11:74938207-74938229 AGAAGCAGGATTGTCAGCAGTGG - Intronic
1085371507 11:76011009-76011031 AGAAGTAGGAATATCAGGAGTGG + Intronic
1086575333 11:88333404-88333426 AGAAGAAGGGATAGAGACAGAGG + Intronic
1086753769 11:90532665-90532687 AGAAACAGTGATATAAACATGGG - Intergenic
1086987002 11:93261613-93261635 AGAAGCAGGATTATAAGGAGGGG - Intergenic
1087710905 11:101550333-101550355 AGACGCAAGGATATAAGCTATGG + Intronic
1089132192 11:116221515-116221537 GGAACCAGGGATTGAAGCAGTGG - Intergenic
1089176750 11:116554150-116554172 AGAAGCAGACATGTAAACAGGGG + Intergenic
1090270423 11:125381954-125381976 AGAAGCAAGGACAGAAGCAGAGG + Intronic
1202804646 11_KI270721v1_random:805-827 AGAAACAGGGATGGAAGGAGTGG + Intergenic
1091735838 12:2921082-2921104 AAAAGCAATGATATAATCAGTGG + Intronic
1091947819 12:4564100-4564122 AGTCTCAGGGATATATGCAGAGG + Intronic
1092232281 12:6782902-6782924 TGAAGGAGGGATAGCAGCAGGGG - Intergenic
1094877857 12:34671832-34671854 GGAAGAAAGGATATCAGCAGTGG - Intergenic
1095514379 12:42990063-42990085 AGACACAGCGATATAAGAAGGGG + Intergenic
1097314652 12:58159222-58159244 AGAGCCCGGGACATAAGCAGGGG + Intergenic
1097338050 12:58406737-58406759 AGCAGCATGCATAAAAGCAGAGG + Intergenic
1097424355 12:59424319-59424341 AGAAGCAGAGATTAAAACAGTGG - Intergenic
1097505629 12:60465845-60465867 TGAAGGAGGGAAATAAGAAGTGG + Intergenic
1097756828 12:63416134-63416156 AAAGGCAGGGTTATAAGGAGGGG - Intergenic
1098060889 12:66561176-66561198 AGAAGCTGGGAAGTTAGCAGGGG + Intronic
1098367085 12:69715348-69715370 AGAGGAATGGATATAGGCAGAGG - Intergenic
1098543823 12:71688547-71688569 AGAAACATAGATACAAGCAGTGG + Intronic
1098961831 12:76746813-76746835 GAAACTAGGGATATAAGCAGAGG - Intergenic
1099228268 12:79994031-79994053 AGAAGAAGAAATATAAGAAGAGG - Intergenic
1099426129 12:82524868-82524890 AGAAGCTATGATATAAGCAGCGG + Intergenic
1103709775 12:122903690-122903712 AGAAGCTGGGAGAAAAGCAAGGG - Intergenic
1104259987 12:127173422-127173444 AGAAACAGAGTTATAAGCACTGG - Intergenic
1104302442 12:127576642-127576664 AAAAGAAGGGATATAAGCTTGGG - Intergenic
1105676578 13:22678665-22678687 AGGAGAAGGGATGTAAGCAGAGG - Intergenic
1106078453 13:26480881-26480903 ATAATCATGGATATAAGCAAAGG + Intergenic
1106316674 13:28600403-28600425 AGCAACAGTGATACAAGCAGAGG + Intergenic
1106712523 13:32353331-32353353 AGGAGTAGGGAGGTAAGCAGGGG - Intronic
1107269925 13:38603156-38603178 TGGAGAAGGAATATAAGCAGGGG - Intergenic
1108734834 13:53272083-53272105 AGTAGCAGTGAAATAAGAAGTGG + Intergenic
1112004801 13:95245059-95245081 AGAAGCAGGCACAGAAGTAGAGG - Intronic
1112724087 13:102282042-102282064 AGAAGCAGGGTTAGGAGAAGCGG - Intronic
1113545908 13:111150190-111150212 AGAATAAGGGATAAATGCAGTGG + Intronic
1115104935 14:29749293-29749315 AGAAGTAGGGAAAAAAGGAGGGG + Intronic
1116056632 14:39872308-39872330 AGAATCAGTGATAGAAGCAAAGG + Intergenic
1116940212 14:50783732-50783754 AAAAGCAGGGAGAGAAGGAGGGG + Intronic
1117205224 14:53435528-53435550 AGAAGCAAGGAGATAAGCCTGGG - Intergenic
1119097767 14:71849760-71849782 GGAAGCGGGGACCTAAGCAGAGG - Intergenic
1120917496 14:89722743-89722765 AGAAGCAGGCATAGAAGCCAAGG - Intergenic
1120956455 14:90087535-90087557 AGAAGCGGGGATGGAGGCAGTGG - Intronic
1121877775 14:97469646-97469668 AGAATCAGGGGTATTAGAAGGGG + Intergenic
1122047271 14:99033157-99033179 AGGAGCAGGGATAGCAGAAGGGG - Intergenic
1122140824 14:99662009-99662031 AGAATCAGGGGTAAAAACAGAGG - Intronic
1122239913 14:100356438-100356460 AAAATCAGGAATATAAGAAGGGG + Intronic
1123428612 15:20194234-20194256 ACAAGCAAGGATAGAAACAGTGG + Intergenic
1124212866 15:27777370-27777392 AGAAGCAGAGAAAAAACCAGGGG - Intronic
1124463114 15:29911361-29911383 AGAGGCAGGAAAATAAGAAGGGG + Intronic
1126103232 15:45132043-45132065 AGAAGCATGGTTAGGAGCAGAGG + Intronic
1126257288 15:46642854-46642876 AGAAGAGGGGAAATATGCAGAGG - Intergenic
1126409200 15:48354539-48354561 AGAAGCAGACAGAGAAGCAGAGG + Intergenic
1127747932 15:61999939-61999961 ATACGCAGGTATATAAGCATGGG + Intronic
1128151985 15:65368871-65368893 AGAAGCAGAGAGAGAAACAGAGG + Intronic
1128610270 15:69067492-69067514 AGAAGCAGAGACATAAGCTAGGG - Intergenic
1128770559 15:70278622-70278644 GGAAGCAGGGACAGAAGGAGGGG - Intergenic
1129519772 15:76178301-76178323 AGAAGCTGGGCTTTAGGCAGAGG + Intronic
1130277480 15:82489027-82489049 AGAGGCAGGGTTATAAAGAGGGG - Intergenic
1130469806 15:84216216-84216238 AGAGGCAGGGTTATAAAGAGGGG - Intergenic
1130477294 15:84330779-84330801 AGAGGCAGGGTTATAAAGAGGGG - Intergenic
1130494471 15:84457351-84457373 AGAGGCAGGGTTATAAAGAGGGG + Intergenic
1130592095 15:85220840-85220862 AGAGGCAGGGTTATAAAGAGGGG - Intergenic
1130761235 15:86822316-86822338 AGAAGCAGGAATTTGAGAAGGGG - Intronic
1132938158 16:2492570-2492592 GGAAGGAGGGATGTAAGCTGTGG + Intronic
1133684241 16:8150588-8150610 AGAAGCATGGCTGGAAGCAGTGG + Intergenic
1133960300 16:10487255-10487277 AGAGGCAGGGTTATAAGGAGGGG - Intergenic
1134448179 16:14346446-14346468 AGAGGTAGGGATTGAAGCAGAGG + Intergenic
1134619400 16:15676177-15676199 AGAAGGAGGGAGAAAAGGAGGGG - Intronic
1135271280 16:21071833-21071855 AGAAGCAGGAATATAGGGAAAGG - Intronic
1136155347 16:28378415-28378437 AGAAGCACTGATGTAGGCAGAGG - Intergenic
1136207736 16:28736873-28736895 AGAAGCACTGATGTAGGCAGAGG + Intergenic
1137468578 16:48733823-48733845 AGAAGCAGGGTAATATGTAGGGG + Intergenic
1137734831 16:50716100-50716122 AGAAACAGGCATATAGGCTGTGG - Intronic
1138178465 16:54926880-54926902 AGAAACAGGAATATAATAAGAGG - Intergenic
1138646399 16:58428526-58428548 AGATGCAGTGACAGAAGCAGAGG + Intergenic
1138691459 16:58772628-58772650 AGAAGCAGGGATGGTGGCAGGGG - Intergenic
1138849918 16:60615301-60615323 TGAAGCAGGGAGGTAAACAGAGG - Intergenic
1140974626 16:80046974-80046996 AGAAACAGGGAAGTAAGCTGAGG + Intergenic
1141607711 16:85164466-85164488 AGAAGCAGGGATTTCCCCAGGGG - Intergenic
1142869601 17:2811422-2811444 AGAAGCAGGAAAAGAACCAGGGG - Intronic
1143135566 17:4710646-4710668 AGGAGCAGGGATCTTGGCAGCGG + Intronic
1143550306 17:7626694-7626716 AGAAGCAAGGGTATATGGAGGGG - Intronic
1143774987 17:9193315-9193337 AGAAGTAGGGAGAAAAGCATGGG + Intronic
1143975210 17:10824416-10824438 AGATGCAGAGATAGAGGCAGGGG + Exonic
1144242987 17:13332204-13332226 AAAAGCAGGGAGATAAAAAGAGG - Intergenic
1147120700 17:38333640-38333662 AGAAGCAGGTATACAGGGAGAGG - Intronic
1147493711 17:40895807-40895829 TGAGGCAGGGAAATGAGCAGAGG + Intergenic
1147931173 17:43982581-43982603 AGAAGCAGGGGGACTAGCAGGGG + Intronic
1148377319 17:47159980-47160002 AGAAGCAGAGGTTTCAGCAGTGG - Intronic
1148790540 17:50170284-50170306 AGAAGCAGGGCCACCAGCAGGGG - Exonic
1150463191 17:65370291-65370313 AGAAACAGGGACAGAGGCAGAGG - Intergenic
1151236031 17:72720330-72720352 AGAAACAGGAGTAGAAGCAGTGG + Intronic
1151244676 17:72785232-72785254 AGAAGCAAGGATATAGGATGAGG + Intronic
1151665292 17:75542223-75542245 AGAAGAAGGTATCTAAGCTGAGG - Intronic
1151982747 17:77523693-77523715 AGAGGCAGAGATATAGACAGAGG - Intergenic
1153250058 18:3112418-3112440 AGAAGCAGGTGTAGAAGCAATGG + Intronic
1153872315 18:9332858-9332880 AGAAGCAGATATAAAAACAGTGG + Intergenic
1153955800 18:10095090-10095112 AAAACCAGGGATGTAAGCATAGG - Intergenic
1154084305 18:11287430-11287452 AGAAGTAAGGATATCAGCACTGG - Intergenic
1155094085 18:22539189-22539211 TAAAGCAGGGATAGAAGCAGTGG + Intergenic
1156853658 18:41756620-41756642 AGAAGGAGGGGGAAAAGCAGGGG + Intergenic
1156901973 18:42310530-42310552 AGAAGGAGTTATATAAGCCGTGG - Intergenic
1158126101 18:54101039-54101061 AGAAGCAGCAATATGAGAAGAGG + Intergenic
1158150658 18:54365508-54365530 AGAAGCAGGGAGATAAGAAGGGG + Intronic
1159052572 18:63435242-63435264 AGAGGCAGGCATAAAAGCATAGG - Intergenic
1159636301 18:70809138-70809160 AGCAGCAGGGATTTTGGCAGAGG + Intergenic
1160945398 19:1640529-1640551 AGAAACACTGATGTAAGCAGTGG + Intronic
1162448184 19:10737340-10737362 AGAAGGAGGCTTTTAAGCAGAGG - Intronic
1165372500 19:35418055-35418077 AGAGGCAGGGATGGAAGCATAGG + Intergenic
1165465000 19:35968815-35968837 AGAAGCAATGATATAGGCTGGGG + Intergenic
1165937272 19:39397065-39397087 AGAAGCAGGCAGAAAACCAGGGG + Intronic
926305818 2:11636802-11636824 AGAGGCAGGGACAGAGGCAGGGG + Intronic
926305826 2:11636832-11636854 AGAGGCAGGGACATGGGCAGAGG + Intronic
926358544 2:12063803-12063825 AGATGCAGCAATAGAAGCAGCGG + Intergenic
928182870 2:29081800-29081822 ATAAGCAGGGTTATAAGCAGTGG - Intergenic
929016234 2:37498842-37498864 AGTAGCAAGCATGTAAGCAGAGG - Intergenic
929396328 2:41527245-41527267 AGAAGCAGGGGTATAAAAATAGG - Intergenic
930353192 2:50283822-50283844 AGAAGAATGGATATAGGGAGAGG - Intronic
930928621 2:56852215-56852237 TGAAGCAAGCATAGAAGCAGAGG - Intergenic
931144179 2:59498811-59498833 AGTAGCAGGAATAATAGCAGTGG + Intergenic
932002081 2:67894273-67894295 AGAAGAATGGGGATAAGCAGAGG - Intergenic
932466167 2:71925735-71925757 AGAAGGAGGGCTAGAATCAGAGG - Intergenic
935706613 2:105862831-105862853 AGAAGCAGACATATCAGCAGTGG + Intronic
936660729 2:114540801-114540823 AGCAGGAGGCGTATAAGCAGAGG - Intronic
937202104 2:120210298-120210320 CGAAGCAGGGGTACAGGCAGAGG + Intergenic
937649174 2:124300616-124300638 AGTGGCAGGGATAGAAGCACTGG + Intronic
937729757 2:125214481-125214503 AGAAACACGGAAATAAGCAGAGG - Intergenic
937820654 2:126306959-126306981 AGACACAGAGACATAAGCAGAGG - Intergenic
938036401 2:128038469-128038491 AGAGGCAGGGTTATAAGGAGGGG - Intergenic
939001832 2:136745607-136745629 GGGAGCAGGGACATAAGCATGGG - Intergenic
939397869 2:141654552-141654574 AGAAGCAAGCAGATGAGCAGGGG - Intronic
940470846 2:154098293-154098315 AGGAGGAGGGAGATAATCAGGGG - Intronic
941587887 2:167382432-167382454 AGAAGGAGGGAGATAGGGAGAGG - Intergenic
941786146 2:169500612-169500634 AGAAGAAGAGATATAAGTAATGG - Intronic
941888644 2:170555188-170555210 AGAAACAGGGAGAAAAGGAGAGG - Intronic
942161807 2:173196773-173196795 AGAAGCAGGAAGAGAACCAGTGG - Intronic
943302567 2:186222503-186222525 TGAAGCAAGGCTATAACCAGAGG + Intergenic
943351787 2:186805466-186805488 AGAGGCAGGGACCTTAGCAGTGG + Intergenic
943729379 2:191285749-191285771 AGAAGCAGAGACATGGGCAGGGG + Intronic
944075779 2:195729428-195729450 AGAAGCAAGGTTATCAGCTGAGG - Intronic
944625934 2:201568881-201568903 AGAACCAGGGAAATAACCACTGG + Intronic
944777309 2:202979866-202979888 AGAAGAATGGATTTAAGCACTGG - Intronic
945829891 2:214771059-214771081 AGAAGGAGGCATTTATGCAGCGG + Intronic
946072676 2:217047846-217047868 AGAAGCAAAAATATAAACAGAGG - Intergenic
946644510 2:221818396-221818418 AGAAGAAGGGCAACAAGCAGTGG + Intergenic
946739151 2:222784953-222784975 AAAAGCAGGGATATGACCACAGG - Intergenic
947389439 2:229623837-229623859 TGCAGCAGGGAGAGAAGCAGAGG - Intronic
948922634 2:241072911-241072933 AGAAGCAGGGGTGGAAGGAGAGG + Intronic
1169611230 20:7382285-7382307 AGAACCAGGGAAATAACCATAGG + Intergenic
1169692253 20:8344876-8344898 AGAAGAAAAGATATAAGCATTGG + Intronic
1170691050 20:18615250-18615272 AGCAGCAGGGTTATGAGCTGTGG - Intronic
1170716466 20:18835713-18835735 AGAAACAGGAATATAAGAAAGGG - Intergenic
1170955331 20:20974343-20974365 AGAAGCAGAGGTAGAAGCAGAGG - Intergenic
1172865114 20:38089954-38089976 GGAAGAAGGGATAGAACCAGGGG - Exonic
1173285729 20:41670158-41670180 AGGAGCAGGGCTATCAGCACAGG + Intergenic
1174106536 20:48166181-48166203 AGAGACAGGGAAAGAAGCAGTGG + Intergenic
1174268826 20:49351906-49351928 AGGAGCAGGGAGGTTAGCAGGGG - Intergenic
1177067011 21:16451273-16451295 AGATACAGGAATATTAGCAGAGG - Intergenic
1177895316 21:26850554-26850576 ACTAGCAGGGATTTAATCAGAGG + Intergenic
1178218618 21:30629554-30629576 ACAAGCAAGGATTCAAGCAGTGG + Intergenic
1179027691 21:37693486-37693508 ACAAGCCGGGAGAGAAGCAGGGG + Intronic
1179322253 21:40303226-40303248 TAAGGCAGAGATATAAGCAGAGG - Intronic
1180084676 21:45502654-45502676 ACAAGCAGGGATTTCAGCAAAGG + Intronic
1180280158 22:10686244-10686266 AGGAACAGGGAAATCAGCAGGGG + Intergenic
1183315263 22:37133575-37133597 AGAAGCAGGGCTCTCATCAGGGG + Intronic
1184884484 22:47334043-47334065 AGGAGCAGGGATACAGGAAGGGG + Intergenic
1185062162 22:48612705-48612727 AGAGACAGGGATGGAAGCAGAGG - Intronic
949610442 3:5698500-5698522 AGAGGCAGGGTTATAAGGAGGGG + Intergenic
950846768 3:16022684-16022706 AGAGTCAGGGGTATAAGGAGAGG + Intergenic
952114006 3:30158046-30158068 AGAAGCAGGGTTGGAAGCAGTGG + Intergenic
952595158 3:35008654-35008676 AGAGGCAGGAGTAGAAGCAGGGG - Intergenic
953538145 3:43791409-43791431 ACAAGCTGGGCTGTAAGCAGAGG - Intergenic
953609491 3:44435745-44435767 AGAACCAGGGAAATAACCATAGG + Intergenic
954343234 3:49973061-49973083 AGAAGCAGGGAGATAACCTGAGG - Intronic
954615959 3:51968635-51968657 AGAAGGAAGGGTAAAAGCAGGGG + Exonic
954869132 3:53753898-53753920 AGAAGCAGGGAGATTAGAATTGG + Intronic
955480194 3:59382181-59382203 AGAGCCAAGGATATAGGCAGGGG - Intergenic
955627838 3:60938144-60938166 AAAAGCAGTGAGAAAAGCAGAGG + Intronic
957102823 3:75849752-75849774 GGAAGAAGGGATATCAGCAATGG - Intergenic
958995335 3:100898158-100898180 ACAGGCAGAGATATAAGCAGAGG - Intronic
959362526 3:105411411-105411433 AGTAGCAGTGATAGTAGCAGTGG + Intronic
960986618 3:123285210-123285232 AGATGCAGTGAGATAAGCAAAGG - Intronic
961044056 3:123696644-123696666 AGAAGCAAGGATAGAAGTAATGG - Intronic
961224086 3:125223541-125223563 AGGGGCAGTGAAATAAGCAGAGG - Intergenic
961492410 3:127264906-127264928 AGCAGCAGGGGCATAAGCATAGG + Intergenic
962368528 3:134802126-134802148 AGAAGCAGTGGTAGAAGCAGGGG + Intronic
962754719 3:138458737-138458759 AGCACCTGGGATGTAAGCAGTGG + Intronic
963631611 3:147738590-147738612 AGATGAAGGGATATGGGCAGGGG - Intergenic
964006256 3:151832915-151832937 AGAAGCAGTGATGGTAGCAGTGG + Intergenic
967428042 3:189350193-189350215 AGAAGCTGGGATTGAAGAAGAGG + Intergenic
968078856 3:195833160-195833182 AGAAGCAGAGATAAAGGCAGTGG + Intergenic
969429244 4:7144741-7144763 AGAAGCTGGGCTCTGAGCAGGGG - Intergenic
969984049 4:11188668-11188690 AGAACCAGGGTGGTAAGCAGTGG - Intergenic
970741065 4:19238385-19238407 ATAAGAAGGGAAAGAAGCAGAGG - Intergenic
971574742 4:28257989-28258011 AGATGCAGGGGTTTAAGAAGGGG - Intergenic
971605259 4:28650924-28650946 AGAAGAAGGGATCTAGGTAGTGG + Intergenic
971736072 4:30454238-30454260 ATACGAAGGAATATAAGCAGTGG + Intergenic
972866572 4:43240405-43240427 AGAAGGAAGGAGAGAAGCAGAGG + Intergenic
973107118 4:46353791-46353813 AAGAGCAGGGAAATAAGAAGTGG - Intronic
973574593 4:52273961-52273983 AGAAGAAGGGACATTAGTAGTGG - Intergenic
974841706 4:67306892-67306914 AGAAGGAGGTAGAGAAGCAGAGG - Intergenic
975454999 4:74579611-74579633 CAAAGCAGGCATATAAACAGTGG - Intergenic
976488840 4:85642733-85642755 AGAAGCAGGGAAATAAGCAAAGG - Intronic
977650095 4:99459516-99459538 AGAAGGAGGGATATAAGTCAGGG - Intergenic
978018139 4:103774065-103774087 AGCAGCTGGTATGTAAGCAGAGG - Intergenic
978039953 4:104047893-104047915 AGAAGCAGGGATATTGTCACGGG + Intergenic
978434145 4:108665384-108665406 AGAAGCAGGGTCAAAAGAAGAGG + Intronic
981773265 4:148334872-148334894 AGAAGCGAGGAGAGAAGCAGGGG - Intronic
983278618 4:165651824-165651846 AGAAAGAGGGAAAGAAGCAGAGG - Intergenic
983432371 4:167667475-167667497 AGAAGCAGGGAGATAGAGAGAGG + Intergenic
985705607 5:1399909-1399931 AGGAGCAAGGATACAGGCAGAGG - Intronic
987214061 5:15714565-15714587 AGAGGCAGGGCTAGGAGCAGTGG + Intronic
995934706 5:117495810-117495832 AGAAGTTGGGAAATGAGCAGAGG - Intergenic
996242144 5:121216682-121216704 CCAAGCAAGGATATGAGCAGAGG + Intergenic
997580911 5:135016343-135016365 AGAAGGAGGGATCCAAACAGAGG + Intergenic
997721088 5:136079019-136079041 AGAAGCCAAGATATTAGCAGTGG - Intergenic
997841902 5:137248753-137248775 AGAAGCTGGAATATAGCCAGTGG + Intronic
999055688 5:148573661-148573683 AGAAGCAGTGGCATGAGCAGTGG + Intronic
1000232229 5:159326785-159326807 ATAAGAAGGGAGAGAAGCAGGGG + Intronic
1000475642 5:161703591-161703613 AGAAGAAGGGATAAAAGAATAGG - Intergenic
1003246362 6:4385563-4385585 AGAGGCAGGGTTATAAGGAGGGG - Intergenic
1004280308 6:14274884-14274906 AGAATCAGGCACATAGGCAGAGG + Intergenic
1005535251 6:26749026-26749048 AGAAGGAAGGATGGAAGCAGGGG + Intergenic
1006292812 6:33153201-33153223 AGAGGCAGACATATATGCAGAGG + Intergenic
1007351422 6:41276322-41276344 TGGAGCAAGGATCTAAGCAGAGG - Intronic
1007716197 6:43857614-43857636 AGAGGCAAGGATGTTAGCAGAGG + Intergenic
1007753383 6:44083389-44083411 AGATGCAGAGAAACAAGCAGAGG + Intergenic
1012061928 6:94496343-94496365 ACACGCAGGGTTTTAAGCAGTGG - Intergenic
1012172387 6:96034190-96034212 TGAAGCAGGCACAGAAGCAGAGG + Intronic
1012186748 6:96226587-96226609 ATAAGCAGGGAGATAGACAGTGG + Intergenic
1013366755 6:109442918-109442940 AGAAGGAGGGAGAGAAGCTGGGG - Intronic
1014887241 6:126796786-126796808 AAAAGCCAGGATATAAGCAGAGG - Intergenic
1014950202 6:127545347-127545369 AGAAACAGGGATAGAAGGAAGGG - Intronic
1015201603 6:130587706-130587728 AGAAGAAACGATATATGCAGAGG + Intergenic
1015396988 6:132745676-132745698 AGAAGAAGGAATATGATCAGAGG + Intronic
1015498958 6:133910417-133910439 AGAAGGAGGAATAAAAGGAGGGG + Intergenic
1016389532 6:143561124-143561146 ACAAGCAGGGATTGAAGGAGAGG + Intronic
1016408011 6:143751386-143751408 AGATGGAGGGAAAAAAGCAGAGG - Intronic
1016740735 6:147526125-147526147 AAAAGCATGGATATGTGCAGAGG + Intronic
1017659330 6:156658505-156658527 CCAAGCAGGGAAATAGGCAGGGG + Intergenic
1017837340 6:158190460-158190482 AGAGGCAAGGATGGAAGCAGGGG - Intronic
1018719624 6:166562932-166562954 AGAAGCAGGGGTACAAGGACAGG + Intronic
1020823169 7:12995900-12995922 AGAAGGAGTGAGATAAGAAGTGG + Intergenic
1022695560 7:32702282-32702304 GGAAGAAAGGATATAAGCAATGG - Intergenic
1023119804 7:36897916-36897938 AGAGGAAGGGATATAAGCAGTGG + Intronic
1023517362 7:41015170-41015192 AGAAGCAGAGATCGAAGAAGAGG + Intergenic
1023704481 7:42927094-42927116 GGAAGTAGTGATATAATCAGTGG + Intronic
1025027299 7:55527057-55527079 AGGACCAGGGACAGAAGCAGAGG + Intronic
1026238026 7:68545759-68545781 AGAAGGAGGGAGAGAAGGAGGGG - Intergenic
1028230384 7:88300708-88300730 AGAAGCAGGGGAAGAACCAGTGG - Intronic
1028914680 7:96244921-96244943 GGAGGCAGTGATATATGCAGAGG - Intronic
1030661484 7:112223717-112223739 AGAAGCAGGGATATAAGCAGAGG + Intronic
1030903511 7:115153259-115153281 AGAAGGATGAATATAAGGAGAGG + Intergenic
1032241585 7:130163404-130163426 AGAAAAAGGGATGTAAGTAGAGG + Intergenic
1032288565 7:130564975-130564997 AGAAGCAGCAATTTTAGCAGGGG + Intronic
1032626931 7:133601583-133601605 AGAAGTAGGGAAAGTAGCAGTGG - Intronic
1032885847 7:136137286-136137308 AGGAGCAGAGATATATCCAGGGG + Intergenic
1033646248 7:143306830-143306852 AGCAGAAGGGTTCTAAGCAGGGG - Exonic
1034457455 7:151178758-151178780 AGATGCAGGGCTAGAAGCAGAGG - Intronic
1035727327 8:1832938-1832960 AGAAGCAGAGACAGAGGCAGAGG + Intronic
1035727340 8:1833156-1833178 AGAGGCAGAGACAGAAGCAGAGG + Intronic
1035727344 8:1833190-1833212 AGAAGCAGAGACAGAGGCAGAGG + Intronic
1035727355 8:1833300-1833322 AGAGGCAGAGACAGAAGCAGAGG + Intronic
1035818868 8:2570206-2570228 AGAAACAGTGCTATGAGCAGAGG - Intergenic
1037779530 8:21858285-21858307 AGAAGGTGGGATAAAAACAGAGG + Intergenic
1038341940 8:26693534-26693556 AGGAGCGGGGATACAAGCATTGG - Intergenic
1038883194 8:31637466-31637488 AAGAGCAGAGATACAAGCAGGGG - Intergenic
1041102580 8:54411458-54411480 AGAAGCAGCAATATTAGCAAAGG - Intergenic
1041541705 8:58992152-58992174 AGACGAAGGGGAATAAGCAGAGG + Intronic
1042132951 8:65607101-65607123 AGAAGTAGGGAGATGAGCAATGG - Intronic
1043956101 8:86361299-86361321 AGATGCAGGGGTAAAAGAAGGGG - Intronic
1044123117 8:88422847-88422869 AGAAGCAGGGTGAGAACCAGTGG - Intergenic
1045762199 8:105623307-105623329 AGAAGAATGGAAATAAGAAGGGG - Intronic
1046272335 8:111913469-111913491 AGATGCAAGCATATAATCAGTGG + Intergenic
1047691661 8:127361254-127361276 AGAAGCAGGGATCACAGTAGTGG - Intergenic
1047862951 8:128989063-128989085 ATAAGAAGGGAGAAAAGCAGTGG + Intergenic
1048279389 8:133093974-133093996 AGTAGCAGGGGTAAGAGCAGTGG + Intronic
1048579503 8:135719446-135719468 AGCAGCAGGGATGGAAGGAGAGG + Intergenic
1049142704 8:140970676-140970698 AGCAGCAAGGTTAGAAGCAGGGG - Intronic
1049329677 8:142043531-142043553 AGGGGCAGGGAGATTAGCAGGGG + Intergenic
1049948008 9:616777-616799 AACAGCAGCGACATAAGCAGAGG - Intronic
1050045689 9:1542464-1542486 AGAAGCAGGGAAATAGGAGGAGG - Intergenic
1050243455 9:3661709-3661731 AGCAGCAGTGATAACAGCAGTGG - Intergenic
1050931853 9:11338826-11338848 ACAAGCAGGCATATAAGAAGAGG - Intergenic
1051382521 9:16472635-16472657 AGAAGAAGGATTATAAGAAGTGG - Intronic
1055107326 9:72526765-72526787 AGGAGCAGGAAAAGAAGCAGGGG - Intronic
1055443838 9:76363262-76363284 AGAAGCTGGGAAATAAGGAGGGG - Intergenic
1056103049 9:83318391-83318413 AGTAACATGGATAGAAGCAGAGG - Intronic
1057516456 9:95725959-95725981 AAAAGCAGGAATAAAAGAAGGGG - Intergenic
1058642306 9:107099528-107099550 AGAAGCAGGGAGATCATCTGTGG - Intergenic
1058894062 9:109384529-109384551 AGAAGCAGGGATAGAAACTGGGG - Intronic
1058933207 9:109742953-109742975 GGAAGCAGAGATAGAAGGAGTGG + Intronic
1059023952 9:110604645-110604667 AGAATCAGGGTTTGAAGCAGAGG + Intergenic
1059502310 9:114765789-114765811 AGGAGTAGGGAGATGAGCAGGGG - Intergenic
1059665329 9:116440836-116440858 AAAAGTAAGGATATAAGCATGGG + Intronic
1060295271 9:122338993-122339015 AGAAGCAGAGGTATAGGCATGGG - Intergenic
1060568143 9:124612528-124612550 AGTACCAGGAACATAAGCAGGGG + Intronic
1062459032 9:136655200-136655222 AGCAGCAAGGATATAGGCATGGG + Intergenic
1186414358 X:9370398-9370420 AGAAGGAGGGATGTCATCAGTGG + Intergenic
1186816090 X:13239364-13239386 AAGAGAAGGGATAGAAGCAGAGG + Intergenic
1188613976 X:32134523-32134545 AGAAGCGGGGATGTAAACAAAGG + Intronic
1189559212 X:42175364-42175386 TGAAGCTGGGATAAAACCAGTGG - Intergenic
1190065483 X:47239081-47239103 AGAAGCACTGGTATAAGCAGTGG + Exonic
1190184022 X:48219337-48219359 AGAGGCAGGCAAAGAAGCAGGGG + Intronic
1190199079 X:48344933-48344955 AGAGGCAGGCAAAGAAGCAGGGG - Intergenic
1190663914 X:52679857-52679879 AGAGGCAGGCAAAGAAGCAGGGG + Intronic
1190675508 X:52778565-52778587 AGAGGCAGGCAAAGAAGCAGGGG - Intronic
1191122947 X:56925310-56925332 AGAAGAAGGTATCTTAGCAGTGG + Intergenic
1194063578 X:89234830-89234852 AGAAGCAGTGTTTTAAGCACAGG - Intergenic
1194155938 X:90388789-90388811 AGAAGCATGGATATATGCAAGGG + Intergenic
1194469712 X:94278022-94278044 GGAGACAGGGACATAAGCAGAGG + Intergenic
1194539959 X:95157420-95157442 AGAGGAAGGGATCTTAGCAGTGG - Intergenic
1195753162 X:108177073-108177095 AGAAGCTATGATATAGGCAGTGG - Intronic
1196032304 X:111103767-111103789 AGAAGCAGGGATGGAAGGGGTGG - Intronic
1196891482 X:120294939-120294961 TGAAGCAGGGATGGAAGAAGGGG - Intronic
1197106453 X:122722190-122722212 AGAAGCAGGTACATAATTAGTGG + Intergenic
1198574398 X:137994161-137994183 TACAGCAGGGTTATAAGCAGGGG + Intergenic
1199978506 X:152908147-152908169 AGGAGCAGAGATGTAAGCACAGG + Intergenic
1200080619 X:153574678-153574700 AGAAGCAGGGAGACAAGCGAAGG - Intronic
1200160854 X:154007993-154008015 AGTGGCAGGGGTAGAAGCAGAGG + Intergenic
1200502286 Y:3965733-3965755 AGAGGCATGGATATATGCAAGGG + Intergenic
1200717755 Y:6568936-6568958 AGAAGCAGTGTTTTAAGCACAGG - Intergenic
1202585749 Y:26424971-26424993 AAAAGCAGAGATATTAGAAGAGG - Intergenic