ID: 1030663140

View in Genome Browser
Species Human (GRCh38)
Location 7:112244510-112244532
Sequence ACTGATACGCAGAATGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030663140 Original CRISPR ACTGATACGCAGAATGTCAA TGG (reversed) Intronic
902361975 1:15946848-15946870 ACTGAGACCCAGAAAGTCAGAGG + Intronic
905250885 1:36647624-36647646 ACTGAAACTCAGATTGGCAATGG - Intergenic
907139232 1:52170286-52170308 ACTGATACCAAGAAATTCAAAGG - Intronic
908950768 1:69560277-69560299 AATTATATGAAGAATGTCAATGG - Intergenic
909029968 1:70528185-70528207 ACTGACATGCACAATGTCAAAGG + Intergenic
909038242 1:70620085-70620107 ACTCAGACGGAGCATGTCAATGG - Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
912553762 1:110501214-110501236 ACTGAGACCCAGAAAGTCCAAGG - Intergenic
912744804 1:112237183-112237205 AGTGATATGCAGAAGGTCATTGG + Intergenic
915047749 1:153032666-153032688 ACTCATACGCAGAATGGGATAGG - Exonic
915853605 1:159355009-159355031 ACTGATACCCAGAAATGCAAAGG - Intergenic
915997345 1:160576715-160576737 ATTGATACACAGAGAGTCAAAGG - Intronic
917260984 1:173169008-173169030 ACTAATACTCAGAATATAAAAGG + Intergenic
917768113 1:178245452-178245474 ACTGATACCCAGAATCTACAAGG - Intronic
920207174 1:204300756-204300778 ACTTATCAGCTGAATGTCAATGG + Intronic
922040923 1:221896256-221896278 GCTTATACCCAGAATGTAAAAGG + Intergenic
922193605 1:223340780-223340802 ACTGATAGAGAGTATGTCAAAGG + Intronic
923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG + Intergenic
1063850882 10:10188587-10188609 ACAGGTACCCAGAATGCCAAGGG + Intergenic
1067671323 10:48324819-48324841 ACTGATCTGCTGATTGTCAAGGG - Intronic
1067973521 10:50997609-50997631 TCTGATAAGCAGATTCTCAATGG - Intronic
1071980378 10:90999158-90999180 ACTGTTACGCCGAAAGACAAAGG + Intergenic
1072429932 10:95361839-95361861 ACTGAAGACCAGAATGTCAAAGG + Intronic
1072754724 10:98011702-98011724 ACTGATATGCAGCAAGCCAAAGG + Intronic
1072902274 10:99419088-99419110 CCTGATAAGCAGAATGGCAGAGG - Intronic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1075463833 10:122636688-122636710 ACTGATATGTAGAATGGCCAAGG + Intronic
1078244118 11:9557986-9558008 ACTGATACCAAGAAATTCAAAGG - Intergenic
1079812530 11:25013196-25013218 ACAGATAAACAGAATGTGAAGGG + Intronic
1079925332 11:26485954-26485976 ACTGATATCCAGAATTTAAAAGG + Intronic
1082697296 11:56385004-56385026 ACTAATACCCAGAATCTGAAAGG + Intergenic
1085535527 11:77215014-77215036 AGTGGTACACAGAAAGTCAAAGG - Exonic
1089364985 11:117915955-117915977 ACTGAGGCTCAGAATGTTAATGG + Intronic
1090743610 11:129689867-129689889 ACTGATACACATAATGACTAAGG + Intergenic
1092571478 12:9728085-9728107 ATTTATATGCAGAATCTCAAAGG - Intronic
1093705514 12:22270750-22270772 ACTGCTACGCAGTATATCCATGG + Intronic
1095543493 12:43339114-43339136 ACTGTGACTCATAATGTCAAAGG + Intergenic
1097410529 12:59247129-59247151 AATTATATGAAGAATGTCAATGG - Intergenic
1098692756 12:73509705-73509727 TCTGATGCATAGAATGTCAATGG + Intergenic
1099587571 12:84540165-84540187 ACTGATATCCAGAATATAAAAGG - Intergenic
1104206760 12:126645988-126646010 ACTGACACACACAATGTCATGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1109403609 13:61868665-61868687 AATGCTATGCAGAATGTCAATGG + Intergenic
1112710609 13:102123490-102123512 ACTAACACCCAGAATATCAAGGG + Intronic
1115765076 14:36614884-36614906 ACATATACGAAAAATGTCAAAGG - Intergenic
1115879113 14:37894863-37894885 ACTGATCCTCAGGAAGTCAAGGG + Intronic
1117641496 14:57804235-57804257 ACTTATGTGAAGAATGTCAATGG - Intronic
1118833596 14:69458828-69458850 ATTAAAACGCAAAATGTCAAGGG - Exonic
1122361091 14:101164774-101164796 AGTGATACGAGGTATGTCAATGG - Intergenic
1123136925 14:106036550-106036572 ACTGATAGGCAGAATTTACACGG - Intergenic
1126543981 15:49852642-49852664 ACTGATACCCAAATAGTCAAGGG - Intergenic
1129463202 15:75710191-75710213 ACTGAAAGGCAGAATGTGAGGGG - Intronic
1129721683 15:77881210-77881232 ACTGAAAGGCAGAATGTGAGGGG + Intergenic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1141116101 16:81311148-81311170 TCTGATAGGCACAATATCAAGGG + Intergenic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1142769847 17:2088743-2088765 ACTGAGAGGCAGAATGTCCAGGG + Intronic
1142943723 17:3406642-3406664 AATGCTATGAAGAATGTCAATGG + Intergenic
1153351790 18:4089417-4089439 AATTCTACGAAGAATGTCAATGG - Intronic
1156720975 18:40069775-40069797 ACTGAGACCCAGAAAGTGAAAGG - Intergenic
1158337574 18:56430315-56430337 AATTCTACGCAGAATGTCATTGG - Intergenic
925918009 2:8620892-8620914 ACTGGTAAGTAGAAAGTCAAGGG - Intergenic
926319297 2:11737496-11737518 TCTGATACCCAGAATTTAAAAGG + Intronic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
931461551 2:62454438-62454460 ACTGCTCCCCAGAATGTAAAAGG + Intergenic
939203110 2:139063793-139063815 ACTTATATTCAGAATGCCAATGG + Intergenic
942637835 2:178027680-178027702 CCTGCTACCCAGAATGCCAAAGG + Intronic
947127443 2:226884998-226885020 ACTGACAGGCAGATTGGCAAAGG + Intronic
948087114 2:235260279-235260301 ATAGATACACAGACTGTCAAAGG - Intergenic
1169565109 20:6845358-6845380 ACTGAAACCCAGAGTGTTAAAGG + Intergenic
1174522226 20:51140697-51140719 ACTGACACACAGAAAGGCAAAGG + Intergenic
1174678422 20:52380122-52380144 ACTGATAAGCCAAATGTCATTGG - Intergenic
1177475489 21:21615291-21615313 GCTGATACACAGGATGTCACTGG + Intergenic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1182596543 22:31425218-31425240 ACTGAAACGGAGAATTTCATAGG - Intronic
1183817143 22:40312041-40312063 ACTGCTACACAGAATGTCCAGGG - Intronic
1184763599 22:46560105-46560127 ACTAATACGCAGAATCTACAAGG + Intergenic
955161788 3:56470374-56470396 ATTGATCCCCTGAATGTCAAGGG - Intergenic
958083572 3:88778131-88778153 ACTGATATGCTGAAGTTCAAAGG + Intergenic
961934367 3:130567807-130567829 AATGATACCCAAGATGTCAATGG + Intronic
962815504 3:138993934-138993956 ACTAATACCCAGAATATAAAAGG - Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963516276 3:146312887-146312909 ACTGATACCCAGAAATACAAAGG - Intergenic
964516759 3:157519049-157519071 ACTGAAGCACAGAAAGTCAAAGG - Intronic
970362620 4:15324932-15324954 ACTGATACACAGAAGTTAAAAGG - Intergenic
974968429 4:68794728-68794750 AATTCTACGAAGAATGTCAATGG + Intergenic
974990768 4:69085844-69085866 ACTGATACACAGAAATACAATGG - Intronic
976395202 4:84547889-84547911 CCTGATAGGCAGAAAGCCAAAGG - Intergenic
977320947 4:95515339-95515361 ACTGAGGCTCAGAATGTTAAGGG + Intronic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
979586610 4:122426865-122426887 ACCATTAAGCAGAATGTCAATGG - Intronic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
979974105 4:127174563-127174585 ACTACTATGAAGAATGTCAAAGG - Intergenic
981687645 4:147472224-147472246 ACTGAGACTCAAAAAGTCAAAGG + Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
986251088 5:6059196-6059218 ACTGATTGGCAGAATCTGAAAGG - Intergenic
990528146 5:56649045-56649067 ACAGATATGAAGAATCTCAAAGG + Intergenic
991287918 5:65000214-65000236 ACTGATATCCAGAATATAAAAGG - Intronic
991477556 5:67039343-67039365 ACTGCTAAGCAGAAATTCAATGG - Intronic
993790457 5:92202345-92202367 ACTGCTAGACAGAATGTAAATGG - Intergenic
994364887 5:98902333-98902355 TCTAATATGCAGAATATCAAAGG + Intronic
995223113 5:109673263-109673285 ACTGAGACACAAAATGTTAAGGG - Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
996806811 5:127464686-127464708 ACTGCTGTGAAGAATGTCAATGG + Intronic
1000242806 5:159424237-159424259 ACCGAAACCCAGAATGTCCATGG - Intergenic
1001850883 5:174963910-174963932 ACTGTTGGGCAGTATGTCAAAGG + Intergenic
1008259226 6:49344244-49344266 ACTGATTAGCTGAAAGTCAAGGG + Intergenic
1009847058 6:69146971-69146993 ACTGATAAGCAGAAATTCAAAGG - Intronic
1011161151 6:84391881-84391903 ACTGACACTCAGAATGGCTAAGG - Intergenic
1012756132 6:103232680-103232702 ACTGATAAGCAGCATGTAAATGG + Intergenic
1015574118 6:134652826-134652848 TTTGATACTTAGAATGTCAAAGG + Intergenic
1016493626 6:144634598-144634620 ACTGAAATGCACAATTTCAATGG - Intronic
1018124581 6:160669483-160669505 ACTCATACCCAGAAGGGCAAAGG - Intergenic
1018658180 6:166060530-166060552 AATTATATGAAGAATGTCAATGG + Intergenic
1020478491 7:8627538-8627560 ACTAGTAGGCAGAATGCCAAGGG + Intronic
1020843818 7:13257253-13257275 ATTGATACATAGAATATCAACGG - Intergenic
1022630259 7:32077991-32078013 TCTGAGAGGCAGAATGTCCACGG - Intronic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1029894543 7:103968783-103968805 GTTGTTAGGCAGAATGTCAATGG - Intronic
1030543564 7:110863881-110863903 ACTGATAAGCCCAATATCAATGG + Intronic
1030663140 7:112244510-112244532 ACTGATACGCAGAATGTCAATGG - Intronic
1038347286 8:26744036-26744058 ACTGACACAGAGCATGTCAAAGG + Intergenic
1040075671 8:43226680-43226702 ACTGATACCTAGAATTTCCAAGG - Intergenic
1043277615 8:78419557-78419579 ACTGAAAGGCAGAATTTAAAAGG - Intergenic
1044596454 8:93963589-93963611 ACTAATATGCAGAATCTAAAAGG - Intergenic
1044598778 8:93983375-93983397 ACTGACAGGAAGAATGTCAGAGG + Intergenic
1048956563 8:139542215-139542237 ACTGTTACCCATAATGTCTATGG - Intergenic
1050392557 9:5160764-5160786 ACTGATACGCAGAAATTAAAAGG + Intronic
1056794843 9:89650948-89650970 CCCGTTACCCAGAATGTCAAAGG + Intergenic
1059842828 9:118237323-118237345 ATTTATAGGCAAAATGTCAAAGG + Intergenic
1185921064 X:4093533-4093555 ACTGATATACAGGATGTCAAAGG + Intergenic
1187487351 X:19717031-19717053 AGGGATATGCAGAATGGCAATGG + Intronic
1187767346 X:22657272-22657294 ACTAATATGCAGAATATAAAAGG + Intergenic
1188205278 X:27348235-27348257 ACCAATACGCAGAATGTAGACGG + Intergenic
1188728216 X:33611283-33611305 ACAGATACGCAGGGAGTCAATGG - Intergenic
1189129866 X:38486613-38486635 ACTAATACCCAGAATGTACATGG - Intronic
1193459962 X:81778367-81778389 ACTGATAAACAGAAGGTCTAAGG - Intergenic
1193521870 X:82540433-82540455 ACTGATACCTAGAATGTAACAGG - Intergenic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1196566218 X:117208012-117208034 ACTAATATCCAGAGTGTCAAAGG + Intergenic
1196636432 X:118008017-118008039 ACTGATAACCAGAAAGACAAAGG + Intronic
1197341289 X:125269036-125269058 TCTGATACACAGAAATTCAAAGG - Intergenic
1198132856 X:133715930-133715952 ACTGCTAGGCTGAATGTTAAAGG + Intronic
1198550429 X:137739579-137739601 ACTGATACCCAGAATATACAAGG - Intergenic
1199180683 X:144850207-144850229 AATTATACTCAGAATGTCTAAGG + Intergenic
1201752957 Y:17454073-17454095 ACTGAGACTCAGAAAGCCAAAGG - Intergenic