ID: 1030663266

View in Genome Browser
Species Human (GRCh38)
Location 7:112246076-112246098
Sequence AGGAACTACATTGGTATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030663260_1030663266 6 Left 1030663260 7:112246047-112246069 CCAGGTAGTTCTCAAAAATATAA 0: 1
1: 0
2: 0
3: 23
4: 249
Right 1030663266 7:112246076-112246098 AGGAACTACATTGGTATAAAAGG 0: 1
1: 0
2: 2
3: 12
4: 162
1030663258_1030663266 30 Left 1030663258 7:112246023-112246045 CCTTACACTGTCACTAAAGAATG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1030663266 7:112246076-112246098 AGGAACTACATTGGTATAAAAGG 0: 1
1: 0
2: 2
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030663266 Original CRISPR AGGAACTACATTGGTATAAA AGG Intronic
906445175 1:45890058-45890080 AGGAACTAGATTGGTATAGATGG - Intronic
906804732 1:48769682-48769704 AGGAACTACAGTGGACTAATAGG - Intronic
907378687 1:54066702-54066724 ATAAAATACATTGGTAAAAAAGG + Intronic
908422275 1:63970594-63970616 AAAAAATACATTGGTATAAAAGG + Intronic
911781455 1:101884767-101884789 AGGAAGTACATTGTTAGTAAGGG + Intronic
915756798 1:158268998-158269020 AGAAACTGAATTGGGATAAAAGG + Intergenic
923511693 1:234658781-234658803 AGGAACTGTTTTAGTATAAAAGG + Intergenic
1063154710 10:3368638-3368660 AGGAACCACACTGGTGTCAAAGG - Intergenic
1063502095 10:6564309-6564331 AGGAAATATTATGGTATAAATGG + Intronic
1068227199 10:54120700-54120722 AGGAACTACATAATGATAAAGGG + Intronic
1068644392 10:59449766-59449788 AGGAAGAACATTTGTATACAAGG + Intergenic
1069338721 10:67385758-67385780 AGGAACTACATTCCTACAGAGGG + Intronic
1069389277 10:67915436-67915458 AAGAACTTCATTGGTATTCATGG + Intronic
1070711064 10:78683543-78683565 AGGAACCACCTTGGCACAAACGG - Intergenic
1071685488 10:87750472-87750494 AGGAACTACTTCGGCTTAAATGG - Intergenic
1073104707 10:101025996-101026018 AGGAACTACCTGGCTACAAAGGG + Intronic
1075101219 10:119507492-119507514 AGAAACTGCATTGCTAAAAAGGG + Intronic
1076193149 10:128497041-128497063 AGAAACTACATTGTAATTAAGGG - Intergenic
1079079405 11:17403529-17403551 AGGATCAACATTTGTATAAATGG - Intronic
1079842258 11:25418024-25418046 AGGAACTACCTTGATCCAAATGG - Intergenic
1089063845 11:115647062-115647084 AGGCAATACATTGGCTTAAAGGG + Intergenic
1089224015 11:116900341-116900363 ATGAACTGCAGTGGTAGAAATGG - Intronic
1091935219 12:4429617-4429639 AGGAAAAACATTGGGATAGAAGG + Intronic
1099403699 12:82232793-82232815 TGGAACTACATTGGGAACAATGG + Intronic
1100715867 12:97304488-97304510 AGAAACTACATTGGTAAACTGGG + Intergenic
1103003086 12:117401077-117401099 TGCAACTCCATTGGTAGAAATGG + Intronic
1104070921 12:125344680-125344702 GGGAACTACATTGGCATGAGTGG + Intronic
1105491506 13:20892906-20892928 AAGAACTACACTGTTATAAAAGG + Intronic
1107754962 13:43611172-43611194 TGGAACATCAGTGGTATAAATGG - Intronic
1108269894 13:48749108-48749130 AGGGACCACATATGTATAAATGG - Intergenic
1109790687 13:67243254-67243276 AGGAAGTACAGAAGTATAAATGG - Intergenic
1109842810 13:67942639-67942661 AGAAACTGCATTCGTATAAATGG - Intergenic
1110468302 13:75828279-75828301 AAGTACTTCATTGGTAAAAACGG - Intronic
1112534340 13:100236348-100236370 ATGATCTAAATTGGAATAAAAGG + Intronic
1112670073 13:101625273-101625295 AGGAACTTCTTAGTTATAAATGG + Intronic
1113090797 13:106616081-106616103 AATAACTACAATGGTATAATTGG - Intergenic
1113998808 14:16124323-16124345 AGGAAATATATTCATATAAAAGG - Intergenic
1116200339 14:41785780-41785802 AGGCATTAGATTTGTATAAAAGG + Intronic
1116772263 14:49140640-49140662 AAGTACTACATTAGTATAATTGG - Intergenic
1118129874 14:62951048-62951070 AGGAAATACTTTGGTATATATGG + Intronic
1118534214 14:66741481-66741503 AGGAAGTCCATTAATATAAAAGG + Intronic
1120027219 14:79600103-79600125 AGCAAATACATTGGACTAAAAGG + Intronic
1123227899 15:17064774-17064796 AGGAAATATATTTATATAAAAGG + Intergenic
1126873653 15:53014953-53014975 ATTAAATTCATTGGTATAAAAGG + Intergenic
1129093082 15:73172367-73172389 AGGAACTAAATGGTTATAAGTGG + Intronic
1132337427 15:101057311-101057333 AGGGACTGTATTGTTATAAAGGG - Intronic
1132362506 15:101228801-101228823 GGTAACTACATAGGTAAAAAAGG + Intronic
1133645679 16:7762333-7762355 AGTTATTACATTGGTGTAAATGG + Intergenic
1135197628 16:20407778-20407800 AATAACTACAATAGTATAAATGG + Intergenic
1135848519 16:25941085-25941107 AGGAACTATTTTGGTCTCAATGG - Intronic
1136630194 16:31485475-31485497 AGGGACAACATTGGGAAAAACGG + Intronic
1141525797 16:84610654-84610676 AGGAACTACATTGGTTGACCAGG + Intronic
1147047434 17:37764206-37764228 AGGTTCTACATTGGTAAAAATGG + Intergenic
1147847772 17:43417129-43417151 AGGAATTAGATTGGTATAAATGG - Intergenic
1150111081 17:62500027-62500049 AGGAAATTCATTGTAATAAAAGG - Intronic
1155606271 18:27609670-27609692 AGGCATTGCAATGGTATAAATGG + Intergenic
1156419919 18:36940581-36940603 AGGCATTACATTCATATAAAAGG - Intronic
1157299359 18:46468291-46468313 AGGAACTGCTTTGTTAAAAATGG + Intergenic
1157772716 18:50363782-50363804 AGGAAATACTTTTGTAAAAATGG + Intergenic
1158271889 18:55725563-55725585 AGGAACTTCCCTGGTAGAAAGGG - Intergenic
1159439631 18:68460701-68460723 AGGAAATATATTGGTCAAAATGG + Intergenic
1161295598 19:3518693-3518715 AGGAAGTACATTTGTAAAAGTGG - Intronic
925766446 2:7240499-7240521 AGGAACTGCAATGGTTGAAAGGG + Intergenic
926446046 2:12944499-12944521 AGGAACTCCAGTGGCATAAGTGG + Intergenic
928504340 2:31934343-31934365 AGGAACAGGATTGGTAGAAATGG - Intronic
930314700 2:49783813-49783835 AGGTAATAGATTGGGATAAAAGG + Intergenic
931612074 2:64112300-64112322 AGGGACTAAAGTGGAATAAAGGG + Intronic
936022138 2:109002856-109002878 ATGAACTTCATAGGTAAAAATGG - Intergenic
941368813 2:164638744-164638766 AGGAACTAAGTTGGTAAATATGG + Intergenic
941850478 2:170175187-170175209 AGGAACTACATTGAAAAGAAAGG - Intergenic
942175667 2:173332084-173332106 AAGAATTACATTAATATAAATGG - Intergenic
945638238 2:212386776-212386798 AGGAAACACATTTGAATAAAGGG - Intronic
947906020 2:233763771-233763793 TGGAACAACATTGGGAGAAAAGG + Intronic
948137805 2:235649903-235649925 AGCCACTACTCTGGTATAAAAGG - Intronic
1171742698 20:28919841-28919863 AGGAAATATATTTATATAAAAGG - Intergenic
1174803671 20:53587200-53587222 AGGAACCATATTGCTAGAAAAGG + Intronic
1176324698 21:5381435-5381457 AGGAAATATATTTATATAAAAGG + Intergenic
1176482250 21:7311851-7311873 AGGAAATATATTTATATAAAAGG + Intergenic
1176761440 21:10798239-10798261 AGGAAATATATTCATATAAAAGG + Intergenic
1177278210 21:18943802-18943824 AGTAACTAGATTTGTGTAAAGGG + Intergenic
1177425171 21:20913890-20913912 AGGAAGTAGATTGTTATAAATGG + Intergenic
1177508084 21:22043412-22043434 GGGAAGAACATTGGTGTAAATGG + Intergenic
1180401134 22:12427074-12427096 AGGAAATATATTTATATAAAAGG + Intergenic
1180665500 22:17508128-17508150 TGGGACCACAGTGGTATAAATGG - Intronic
1184319634 22:43730582-43730604 AAGAAATACATTTGTAAAAATGG - Intronic
949219464 3:1613215-1613237 AGGAATAACAATAGTATAAATGG + Intergenic
950330847 3:12154999-12155021 AGGAGCTTCATAGGTAAAAAGGG - Intronic
952245674 3:31588595-31588617 AAAATCTACATTGGAATAAAAGG - Intronic
953239035 3:41132043-41132065 AGGAATTACAATAGTATATATGG + Intergenic
954468455 3:50672618-50672640 ATGAATTACATTGAAATAAAAGG + Intergenic
958858978 3:99422088-99422110 AGGAACTACTTTAGATTAAAGGG + Intergenic
959202153 3:103261159-103261181 GGTTACTACATTGGTAGAAATGG - Intergenic
959326935 3:104948745-104948767 AGGTTATACAATGGTATAAATGG + Intergenic
960827206 3:121801696-121801718 AGGAACTACAATGAAATACAAGG - Intronic
962422492 3:135240720-135240742 AGGAATTGCAATGGTACAAAAGG - Intronic
963411682 3:144936293-144936315 AGGAATGACATTGGTATTTAGGG - Intergenic
965289018 3:166852726-166852748 AGGAAGTAAATTATTATAAAAGG - Intergenic
965605559 3:170494894-170494916 AGGTACTGCTTTGGTAGAAAGGG + Intronic
965653435 3:170958005-170958027 AGTAACTACATGGGTAAATAAGG - Intergenic
968838973 4:2986800-2986822 AGGAACTACAATAGTACTAAAGG - Intronic
971701176 4:29978720-29978742 AGAAACTACATAGATACAAATGG + Intergenic
972460312 4:39295736-39295758 AGGAAGAACACTGGCATAAATGG + Exonic
972810819 4:42583925-42583947 AGAAACAATACTGGTATAAATGG + Intronic
973691103 4:53433164-53433186 ATGAACTACATATTTATAAATGG - Intronic
974704828 4:65499463-65499485 AGGAACTACAGATGTATATATGG - Intronic
974883709 4:67790031-67790053 AGCAAATACATTAGTATACAAGG - Intergenic
975172087 4:71244013-71244035 TGGAATTACATTGTTATAGATGG + Intronic
975382044 4:73711837-73711859 AGGTACTAAATTGGTGAAAAGGG + Intergenic
975948211 4:79734844-79734866 TGGAACTACATTAGAATCAAGGG + Intergenic
976124419 4:81818425-81818447 AAGAAATACATTGGTTTGAAAGG + Intronic
976510758 4:85906966-85906988 AGGGAAGACATTGGTAAAAATGG + Intronic
978433208 4:108654966-108654988 AGGAATGACTTTAGTATAAAGGG - Intronic
979580388 4:122351920-122351942 AGGAACATTATTGGAATAAATGG + Intronic
979768542 4:124492822-124492844 AGGAACTTCATTGGTGTTAATGG + Intergenic
980784879 4:137539817-137539839 AGGCACTATATTGTTACAAATGG - Intergenic
981110426 4:140928228-140928250 AAGTACTACATTAGAATAAAAGG + Intronic
983645454 4:169985950-169985972 GCGAATTACATTGGCATAAATGG - Intergenic
989280481 5:39636420-39636442 ATGAACTACTTTGAAATAAAAGG + Intergenic
990187278 5:53222178-53222200 AGGAAGTTCATTTGTAGAAAAGG - Intergenic
991226768 5:64282431-64282453 ACTAGCTACATTAGTATAAAAGG - Intronic
991993439 5:72364121-72364143 AGGAATTACATTGGCTTAAATGG + Intergenic
993988318 5:94624281-94624303 AGGAAATAAATTGCTTTAAAAGG + Intronic
997278194 5:132616727-132616749 AGGCACTAGACTGGTATAAAAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998389213 5:141776299-141776321 AGGAACTAAATTGGGGTAATGGG - Intergenic
1003358688 6:5402023-5402045 AGGAATTACATTTATATAATTGG - Intronic
1003941271 6:11029674-11029696 AGAAAGTGCAGTGGTATAAAAGG + Intronic
1004275450 6:14231659-14231681 AGGACCGATATTGGTATGAATGG + Intergenic
1006410265 6:33869573-33869595 AGGAACAACATTTGAAAAAAAGG - Intergenic
1008855941 6:56087502-56087524 AGGAAGTACATTGCTAGTAAGGG - Intronic
1010810649 6:80295158-80295180 AAGAACTACATTGATATATTGGG + Intronic
1010911986 6:81569864-81569886 AGGAACTAAACAGGTATAAAGGG - Intronic
1012277170 6:97288515-97288537 AGGAACAACTTTCCTATAAAAGG + Intergenic
1012395379 6:98790507-98790529 AGGAACTACTTGCTTATAAAGGG + Intergenic
1013278080 6:108606119-108606141 AGCAACTAATTTGGTATTAAAGG + Intronic
1014050908 6:116953312-116953334 AGGAACTACATTGGATTTAAAGG + Intergenic
1014250219 6:119107968-119107990 ATGAACTGAATTGGAATAAAAGG + Intronic
1015759187 6:136639728-136639750 ATAAACAACATTGATATAAATGG - Intronic
1019205317 6:170356889-170356911 AGGTATTACTTTGGAATAAAAGG - Intronic
1020488867 7:8753912-8753934 AATAACTATATTGATATAAATGG - Intergenic
1020774676 7:12438070-12438092 ATAAACTATATTGGGATAAATGG + Intergenic
1020821339 7:12971907-12971929 ATGACCTACTTTGGAATAAAAGG - Intergenic
1023378803 7:39585669-39585691 AAGAAATACATTTCTATAAAAGG - Intronic
1026398909 7:69989054-69989076 AAGAAATACTTTGGAATAAATGG + Intronic
1027987612 7:85314294-85314316 GGGAACTTCTTTGGTTTAAATGG + Intergenic
1030347753 7:108454165-108454187 AGGAGTTACATGGGAATAAAAGG + Intronic
1030663266 7:112246076-112246098 AGGAACTACATTGGTATAAAAGG + Intronic
1032040278 7:128553936-128553958 AGGAAATTCATTGTAATAAAAGG - Intergenic
1032178422 7:129652913-129652935 AGAAATTACACTGGTATATAGGG + Intronic
1038656794 8:29460181-29460203 AGGAGATACATTAGCATAAAAGG + Intergenic
1044031435 8:87242431-87242453 AGGATCTGCATTAATATAAAGGG - Intronic
1044471799 8:92578749-92578771 AGGGATTACATTAGTGTAAATGG - Intergenic
1045679568 8:104644193-104644215 AGTAGCTACATGGGAATAAAGGG - Intronic
1046088256 8:109465754-109465776 AGGATTTAGATTGGAATAAAAGG - Intronic
1046221554 8:111223419-111223441 AGTAACAACACTGGTATAGAAGG - Intergenic
1046551365 8:115721946-115721968 AGTAAATACATTAGTATAATAGG + Intronic
1048659562 8:136582909-136582931 GGTAACTACATAGGTATATATGG - Intergenic
1051735702 9:20197355-20197377 AGAAACTACAATGGTGAAAATGG - Intergenic
1052238986 9:26249369-26249391 AGGAACTAAATTTGCATCAATGG + Intergenic
1055022424 9:71684565-71684587 AGGAAGTATATTGGGACAAAAGG - Exonic
1055382804 9:75727273-75727295 AGGAAATACATAAGGATAAATGG - Intergenic
1061570027 9:131472041-131472063 AGGTACTACATAAGGATAAAAGG - Intronic
1203342096 Un_KI270429v1:959-981 AGGAATTATCTTCGTATAAAAGG + Intergenic
1203382486 Un_KI270435v1:69735-69757 AGGAAATATATTTATATAAAAGG + Intergenic
1203402097 Un_KI270519v1:117173-117195 AGGAAATATATTCATATAAAAGG + Intergenic
1188316016 X:28674286-28674308 AGGAAGTACCTTGGTCAAAAGGG - Intronic
1188703201 X:33291484-33291506 AGGCATTACATGGGGATAAATGG - Intronic
1190512077 X:51183134-51183156 AGGAACTACATAGGTTAAACAGG - Intergenic
1193148309 X:78100336-78100358 AGGAAGTTCAGAGGTATAAACGG - Intronic
1194403468 X:93466098-93466120 AGTAACTACATGTGAATAAATGG + Intergenic
1194619638 X:96154241-96154263 AGGAAATTCATTGATATATAAGG + Intergenic
1194619732 X:96155860-96155882 AGGAAATTCATTGATATATAAGG + Intergenic
1195658384 X:107355045-107355067 AGGCACTATATTGGTGCAAAAGG + Intergenic
1197834201 X:130677443-130677465 AGCATCTTCATTGGTATAACAGG - Intronic
1199521747 X:148743700-148743722 AGGAACTACATGAATAGAAAAGG + Intronic
1199579114 X:149343918-149343940 AGGAAAGCCAGTGGTATAAATGG - Intergenic
1201379141 Y:13353776-13353798 AGGAACTACAGATGTAGAAATGG + Intronic