ID: 1030667841

View in Genome Browser
Species Human (GRCh38)
Location 7:112300797-112300819
Sequence CTGAGTGACCAGGAGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030667841 Original CRISPR CTGAGTGACCAGGAGAATGG TGG (reversed) Intronic
900885762 1:5414252-5414274 GTGAATGGCCAGGATAATGGGGG - Intergenic
901117257 1:6857099-6857121 CTGAGTGGTCAGGGGATTGGAGG + Intronic
902476528 1:16691458-16691480 CTGGGTTACTAGGAGAAAGGAGG - Intergenic
902843391 1:19090111-19090133 ATGAGTGATGAGGTGAATGGTGG - Intronic
902913731 1:19622344-19622366 CTCAGTGCCCAGGGGAATGCTGG - Intronic
903051322 1:20603402-20603424 CTGCGTGGCCAAGGGAATGGAGG - Intronic
903360000 1:22771114-22771136 CTGGGTGATCAGGAGTAAGGTGG + Intronic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
904311538 1:29632661-29632683 CTGAGGGGCCAGGAGGCTGGGGG - Intergenic
904311557 1:29632717-29632739 CTGAGGGACTAGGAGTTTGGGGG - Intergenic
904463526 1:30694358-30694380 CTCAGGGAGCAGGAGAGTGGGGG - Intergenic
905432253 1:37932725-37932747 CAGAGTGACTAGCAGAGTGGAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907265603 1:53258432-53258454 CTGAGTGTCCAGCCTAATGGAGG - Exonic
908784118 1:67718238-67718260 CTCTGTGACCAGGACAGTGGTGG - Intronic
911055026 1:93701783-93701805 GTGAGTCACCTGGAGAATGCTGG - Intronic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
914947564 1:152080226-152080248 CTGAGTCTCCAGGAGACTAGAGG + Intergenic
915624985 1:157108984-157109006 CTGTGTAACGAGGAGAGTGGAGG - Intergenic
915918071 1:159953097-159953119 CGGAGTGACCTGGAGCAAGGAGG - Intronic
916076693 1:161204283-161204305 CTGAGGGATTAGGAGAATGAGGG - Intronic
918913275 1:190601188-190601210 ATGAGTGACATGGAGAATGGTGG + Intergenic
919918572 1:202154204-202154226 CTGAGTGAGCATGACAATGAGGG + Exonic
920223839 1:204423986-204424008 CAGAAGGGCCAGGAGAATGGAGG + Exonic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
921841155 1:219830029-219830051 CTGAGCAACTGGGAGAATGGAGG - Intronic
921888194 1:220327307-220327329 CTGAATGATCAGGAGAATATTGG - Intergenic
922503365 1:226112348-226112370 CTGTGTGACCAGGACATGGGTGG - Intergenic
924747292 1:246848102-246848124 CTGAGTGACGAGGGGAGAGGAGG + Intronic
1064877483 10:20011259-20011281 ATGAGCCACCAGGAGAACGGAGG - Intronic
1067767014 10:49094501-49094523 CTGAGGGACCTGGAGCAGGGTGG - Intronic
1068465648 10:57387205-57387227 CTGGGCAACCAGGAGACTGGTGG + Intergenic
1068510096 10:57954904-57954926 GTGAGTGAGAAGGAGAATGGAGG + Intergenic
1070785990 10:79162486-79162508 CTGGGTGAGCAGGAGCATGTCGG + Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071440560 10:85688693-85688715 ATGAGTGGCCAGGTGGATGGTGG + Intronic
1072793808 10:98338844-98338866 CTGGGGGACAAGGAGAAGGGAGG - Intergenic
1072821329 10:98560538-98560560 CTGAGTGGCAAAGAGAAAGGTGG - Intronic
1073175319 10:101552789-101552811 TTGAGTGGCCATGAGCATGGCGG - Intronic
1074609376 10:115006352-115006374 CTGAAACACCAGGAGACTGGCGG + Intergenic
1075794133 10:125106868-125106890 CAGACTCACCAGGAGAATGGAGG + Intronic
1076891126 10:133284003-133284025 CTGAGTGACACGGAGGACGGAGG + Intronic
1077478891 11:2803724-2803746 CTGAGAGGCCAGGAGAAAGAAGG - Intronic
1079014093 11:16854354-16854376 CTGAGTGCCTGGGAGAATGGTGG + Intronic
1080466817 11:32505191-32505213 CTTAGTTACCAGGAGAAAGTGGG + Intergenic
1081113694 11:39171042-39171064 GTGACTGAGAAGGAGAATGGAGG + Intergenic
1082982635 11:59137362-59137384 CTGAGGTACCAGGAAGATGGAGG + Intergenic
1083193529 11:61069296-61069318 CTGAGGGGCCAGAAGAAAGGGGG - Intergenic
1083327348 11:61879557-61879579 CTGGGGCTCCAGGAGAATGGGGG - Intronic
1084031100 11:66480890-66480912 GGGAGCGAGCAGGAGAATGGAGG + Intronic
1085402789 11:76244555-76244577 CTGACTAACCAGGAGAAAGGAGG + Intergenic
1087152488 11:94871165-94871187 CTAAGAGGCAAGGAGAATGGGGG - Exonic
1088591988 11:111411414-111411436 CTCAGTGACCCGAAGAAAGGAGG - Intronic
1088995828 11:114995990-114996012 CTGGGTGTCTAGGTGAATGGAGG - Intergenic
1089738091 11:120563749-120563771 CTGAATGACCTGGGGAAGGGTGG - Intronic
1090875479 11:130785183-130785205 CTGAGGGACCAGGACAGGGGAGG - Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091502086 12:1028123-1028145 CTAAGTGACCATGAAAATGTGGG + Exonic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091829208 12:3537653-3537675 CTGGGTGACTAGGGAAATGGTGG - Intronic
1093860491 12:24160369-24160391 CCTAGTGACCAGGAGGATAGGGG + Intergenic
1094318746 12:29161264-29161286 CTGACTGCCCAGGAGTATGAGGG - Intronic
1095454267 12:42365683-42365705 CAAAGTCATCAGGAGAATGGAGG - Intronic
1095678402 12:44946676-44946698 TTGGGTGACCATGAGATTGGTGG - Intergenic
1095970281 12:47897006-47897028 CTGAATGACCAGGACACTGCAGG + Intronic
1097184449 12:57189113-57189135 CTCAGTGTCCAGGAACATGGCGG - Intronic
1099324678 12:81199638-81199660 CCTAGGGACCAAGAGAATGGTGG - Intronic
1101458176 12:104859564-104859586 GTGGGTGACGGGGAGAATGGTGG + Intronic
1101648455 12:106653164-106653186 CAGAGTGCCTAGGACAATGGAGG + Intronic
1104171459 12:126285637-126285659 CTGAGTCACCAGGAAGTTGGTGG + Intergenic
1104637154 12:130445044-130445066 CTGGGTGGCCAGGAGTATGTTGG + Intronic
1105717543 13:23082157-23082179 CTGCTTCCCCAGGAGAATGGCGG - Intergenic
1106314842 13:28584180-28584202 CCGAGTGACCATGAGAACGGAGG - Intergenic
1107091965 13:36491417-36491439 GTGAGTTACAAGGGGAATGGAGG - Intergenic
1108863718 13:54896016-54896038 CTGAGTGAAGAGGAGAGTGACGG - Intergenic
1109233682 13:59789862-59789884 CTGGGTGACTGGGAAAATGGTGG + Intronic
1110498721 13:76200579-76200601 CTGAGTGGCAAGGAGATAGGAGG - Intergenic
1111261154 13:85742192-85742214 CTAAGTAACTAGGTGAATGGTGG + Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1115966034 14:38889279-38889301 CTGGGGGACCAGGTGAATGATGG + Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117874818 14:60241105-60241127 TGGAGAGAGCAGGAGAATGGAGG + Intergenic
1119003468 14:70904168-70904190 CTGAGTGAGCTGGAAAATGTTGG + Intergenic
1119108094 14:71943296-71943318 ATGTGTGACCATGAGAATAGAGG + Intronic
1122160268 14:99779015-99779037 CTGAGTGCCCAGCACATTGGAGG - Intronic
1122546765 14:102527413-102527435 CCAATTGACCAGGATAATGGAGG - Intergenic
1122757928 14:103997409-103997431 CTGAGAGACTGGGAGGATGGAGG + Intronic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1124241855 15:28034972-28034994 GAGAGTGCCCAGGAGAGTGGAGG + Intronic
1125597362 15:40895383-40895405 GTGAGTCTCCAGGAGAATGAGGG + Intronic
1127957579 15:63866213-63866235 CTGCGTGCCCAGCAGAAAGGAGG + Intergenic
1130999763 15:88930492-88930514 CTGATTGATCAAGAGAATGAGGG + Intergenic
1132485647 16:189378-189400 CTGAGCGGCCAGCAGAAGGGGGG - Intronic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1133092310 16:3413954-3413976 CTGGGTGACCCCGGGAATGGGGG - Intronic
1133586774 16:7203341-7203363 CAGAGAGTCAAGGAGAATGGTGG + Intronic
1133887646 16:9845576-9845598 ATGAGTTACAAGGAGGATGGAGG - Intronic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1137674047 16:50295071-50295093 CTGAGCTACCAGGTGAGTGGAGG - Intronic
1138181367 16:54942387-54942409 CTGAGTCCCCAGGATAATAGGGG + Intergenic
1138833746 16:60408277-60408299 CTGAGTGACCAAGACAAAGGGGG + Intergenic
1139098847 16:63740569-63740591 CTATGTGAACAGGATAATGGAGG + Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139545884 16:67649361-67649383 CTGAGGGAACAAGAGAAAGGAGG - Intronic
1140046912 16:71445889-71445911 CAGAGTGACAAGGAGTAGGGAGG - Intergenic
1140067504 16:71624297-71624319 AGGAGTGACCAGGTGAATGGTGG - Intergenic
1141055491 16:80810037-80810059 CTGAGTATTCAGGTGAATGGAGG + Intergenic
1141690654 16:85594371-85594393 CTGAGTCTCCAGGGGAATTGTGG + Intergenic
1142246084 16:88970691-88970713 CTGAAGGACCAGGAGCACGGAGG + Intronic
1142392532 16:89811606-89811628 CTGGTTGCTCAGGAGAATGGTGG - Intronic
1144643474 17:16952584-16952606 CTGAGAGACCAGGAGAGTGAGGG + Intronic
1144768133 17:17744072-17744094 CTGAGTGACTGTGTGAATGGTGG + Intronic
1146503111 17:33381322-33381344 CTGAGGCACCAAGAGCATGGGGG + Intronic
1147713737 17:42489649-42489671 CTGACTGGCCAGGAGAATTAGGG + Intronic
1148720399 17:49748482-49748504 CTGAGGAATCAAGAGAATGGTGG + Intronic
1148859098 17:50594850-50594872 CTGAGAGACACGGGGAATGGGGG - Intronic
1149439630 17:56663670-56663692 CTGGATGCCCAGGAGAATGACGG + Intergenic
1149833350 17:59890830-59890852 TTCAGTGAGGAGGAGAATGGAGG - Exonic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150733047 17:67712426-67712448 TTGAGTGACCAGGTGGATTGGGG - Intergenic
1151820632 17:76494928-76494950 CTGAGGGAGCAGGAGAACTGGGG - Intronic
1152077012 17:78165972-78165994 CTGAGTGAAGAGGAGTTTGGGGG + Exonic
1152630653 17:81409388-81409410 CTGAGTGGCCTGGGGAAGGGGGG + Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159814036 18:73051794-73051816 CTGAGTGATTAGGAGCAAGGTGG - Intergenic
1160036798 18:75309410-75309432 CTGAGTGGCAGGGAGAAAGGAGG - Intergenic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1161038744 19:2099030-2099052 GTGAGTGACCCAGAGAAGGGAGG + Intronic
1161290861 19:3492658-3492680 GTGAGTGACCGGGGGACTGGAGG + Intronic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1162549698 19:11351615-11351637 CTGAGAGGACAGGAGACTGGGGG + Intronic
1163229659 19:15992659-15992681 CTGAGTGCCCAGGGGCATGGAGG - Intergenic
1165105600 19:33468126-33468148 CTGAGAGACCTGGAGAATGGAGG + Intronic
1165247114 19:34504182-34504204 CTGAGTGACTCCGAGAATGAGGG + Exonic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165733695 19:38162726-38162748 CTGAATCACCACGTGAATGGCGG - Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1166750841 19:45163379-45163401 GTGAGTAACCAGGAGCATGAGGG + Intronic
1166921265 19:46230587-46230609 CAGGGAGACAAGGAGAATGGGGG - Intronic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1168673466 19:58258856-58258878 CAGAGTGACAAGCAGAGTGGAGG + Intronic
925020278 2:563038-563060 CACAGACACCAGGAGAATGGTGG - Intergenic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925274181 2:2637210-2637232 CTGAGTGCCCAGGGGCCTGGAGG + Intergenic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925917159 2:8614959-8614981 CTGGATGACCAGGTGAATGGTGG + Intergenic
926167506 2:10530700-10530722 CTGGGTGACCTGGAAACTGGGGG + Intergenic
926299156 2:11589835-11589857 CTGAGCAGCCAGGTGAATGGTGG + Intronic
926967827 2:18435267-18435289 CTGAGTGACCTGCATAATGTAGG + Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927142256 2:20138467-20138489 CTGAGTGACCAGAAAAAATGAGG + Intergenic
929133674 2:38602763-38602785 CTGCGCGGCCAGGAGACTGGCGG + Exonic
929813075 2:45208219-45208241 CTGGTTGACATGGAGAATGGAGG + Intergenic
931384829 2:61788862-61788884 CTGATTTTCCAGGAGAATGCTGG - Intergenic
934545076 2:95207658-95207680 CTGAGTGTCCGGGAGGAGGGTGG + Exonic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936011965 2:108930603-108930625 CGGCGTGTCCAGGAGGATGGGGG + Intronic
937350390 2:121156682-121156704 CTGAAAGACCAGGACAAAGGTGG - Intergenic
938747562 2:134294106-134294128 CTGAGTGAGGAGGCAAATGGAGG + Intronic
939995872 2:148919017-148919039 CTGAGTAACTAGGTGATTGGTGG + Intronic
940560194 2:155285400-155285422 ATGAGTGACGAGGAGAATTAAGG + Intergenic
940985790 2:160050846-160050868 CTGTGTGAACAGCAGACTGGAGG + Intronic
942420162 2:175798819-175798841 CTGGGTGATCAGGAGAACAGTGG - Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
944351425 2:198731643-198731665 CTGAGTTTCCTGGCGAATGGGGG + Intergenic
945195286 2:207231755-207231777 CTGAGTGATTTGCAGAATGGAGG - Intergenic
945462350 2:210123874-210123896 TTGACTGACAAGGAGACTGGAGG - Intronic
946273873 2:218616063-218616085 GTGAGTGACCTGGATAGTGGGGG + Intronic
947179902 2:227402669-227402691 CTGAGTGACCAGGTGGTTAGAGG + Intergenic
947772576 2:232682319-232682341 CTAAGGGGCCAGGAGAAAGGTGG - Exonic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
1168749653 20:273421-273443 CAGAGTGACAGGGAGAGTGGCGG - Intronic
1169433068 20:5556860-5556882 ATTAGTGCCCAGGAGGATGGAGG + Intronic
1169501363 20:6163779-6163801 CTGAAGGACCAGGAAAAAGGAGG + Intergenic
1170579388 20:17686429-17686451 CTGAGTGATAGGGAGCATGGTGG + Intergenic
1172546667 20:35767308-35767330 CTCAGGGACTAAGAGAATGGAGG - Intergenic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1173441155 20:43077433-43077455 CTGGGTGACCTGGAGTATAGCGG + Intronic
1175337267 20:58204850-58204872 TGGAGTGACCGAGAGAATGGTGG - Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1177488789 21:21794193-21794215 CTGAGGAACCAAGAGAATGCCGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180173077 21:46070782-46070804 ATGAGTGGCCAAGAGAAAGGCGG - Intergenic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1182173101 22:28253771-28253793 CTGAGTGACCAGGTAAATGATGG + Intronic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183107775 22:35627330-35627352 CTGAGTGACCGGGCAGATGGTGG + Intronic
1183163582 22:36131220-36131242 GTGACAGACCAGGAGGATGGGGG - Intergenic
1183956304 22:41382326-41382348 CTGGATGACCAGGAGCCTGGAGG + Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184235262 22:43179840-43179862 CTGAGGGACCTGGACACTGGCGG - Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
949562996 3:5220218-5220240 CTCAGTGGCCAAGAGAAAGGAGG - Intergenic
950779880 3:15382266-15382288 CTGAATGATCTGGAGAATGGAGG - Exonic
952062835 3:29531146-29531168 TTTTGTTACCAGGAGAATGGTGG + Intronic
955085742 3:55700892-55700914 ATGAGTGACCAAAAGAATGAAGG + Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955981963 3:64535955-64535977 CTGAGTGGAAAGCAGAATGGAGG - Intronic
956077708 3:65523532-65523554 TGGAGTGACCAGGTGACTGGAGG + Intronic
956308139 3:67849260-67849282 TTGAGTGATCAAGAGAGTGGAGG - Intergenic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
959121031 3:102232330-102232352 CTGGGTGCCCAGTAGAATGGTGG + Intronic
961557721 3:127708039-127708061 CTGAGTGAGCAGGACTATGGGGG - Intronic
963893050 3:150657559-150657581 CTGAGTGACTGGGAGATTGGGGG - Intergenic
965582128 3:170279878-170279900 CTTGGTGACCAAGAGATTGGGGG - Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
967751317 3:193119326-193119348 CTGAGTTACAGAGAGAATGGGGG - Intergenic
968062582 3:195737312-195737334 CTGAGTGACTGGGACAATGGTGG + Intronic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
970550730 4:17178405-17178427 CAGAGTGAACAGGGAAATGGAGG + Intergenic
970681319 4:18511850-18511872 GTCAGTTACCTGGAGAATGGAGG + Intergenic
972097448 4:35365264-35365286 CTGAGAGAGAAGGAAAATGGCGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
973845268 4:54905268-54905290 CAGTGTTACTAGGAGAATGGGGG + Intergenic
976416089 4:84777095-84777117 CTTGGTGACTAGGGGAATGGTGG + Intronic
976826686 4:89268398-89268420 CAGAGTGATTAGGAGAATGTTGG + Intronic
978105506 4:104897435-104897457 CTGGGTGACCAGGAGTATACTGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980254887 4:130366333-130366355 CTGAGTAATCAGGTGAATAGTGG - Intergenic
980816827 4:137958666-137958688 CTCAGTGACTGGGATAATGGTGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
983726687 4:170937711-170937733 GTGAATGGCCAGGAGAATTGAGG + Intergenic
983871214 4:172826921-172826943 CTGAGAGTGGAGGAGAATGGAGG - Intronic
988680468 5:33480185-33480207 CTGATTTAACAGCAGAATGGTGG + Intergenic
989255245 5:39359208-39359230 CTAAGTAACTTGGAGAATGGTGG + Intronic
989415715 5:41172920-41172942 CTGAGTGAGCAGGTGAATTAAGG - Intronic
990595261 5:57306628-57306650 CTGAGTTATCAGCAGAATAGGGG - Intergenic
993369585 5:87075759-87075781 CTAAGTGACAAGGAGAATCTGGG - Intergenic
995831024 5:116356406-116356428 ATCAGAGACCAGGAGAATGGAGG + Intronic
995943429 5:117612600-117612622 CTGAGTGTTCAGGAAAATAGTGG - Intergenic
996892887 5:128443607-128443629 CTGAGTAATTAGGAAAATGGTGG - Intronic
997118481 5:131150762-131150784 CTGAGTCAACAGCATAATGGTGG + Intergenic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
999878185 5:155831806-155831828 CTGCCTGATGAGGAGAATGGAGG + Intergenic
1000418501 5:161010146-161010168 ATGAGTGAGGAGGAAAATGGTGG - Intergenic
1001196305 5:169676345-169676367 CTGAGTGAGTGGGCGAATGGTGG + Intronic
1001505455 5:172275865-172275887 CCGAGTGACCAGGAATATTGAGG - Intronic
1002303879 5:178272445-178272467 CTCAGCGACCATGAGACTGGTGG - Intronic
1002437166 5:179238685-179238707 GTGAGTGAGAAGGAAAATGGAGG + Intronic
1003522799 6:6873023-6873045 CTGAGTGACCAGGAGACCACAGG + Intergenic
1003684340 6:8286140-8286162 TTGAGTGAACAGAAGAATAGAGG - Intergenic
1005529308 6:26686693-26686715 CTGAGTGACCAACTGAATGAAGG - Intergenic
1005541488 6:26814953-26814975 CTGAGTGACCAACTGAATGAAGG + Intergenic
1005626777 6:27669855-27669877 CTCAGCGACCAGGAAGATGGTGG - Intergenic
1006081940 6:31572842-31572864 GTGAGGCAGCAGGAGAATGGGGG + Intronic
1007426740 6:41751411-41751433 TTGAGTGACTCTGAGAATGGAGG - Intronic
1008757660 6:54816753-54816775 CTGAGTGACTAGAAGAATAGTGG - Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011710151 6:90044786-90044808 TTAAGTGACCAGATGAATGGGGG + Intronic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013061619 6:106639516-106639538 CTGAGAGAAAAGGAGAATAGGGG - Intronic
1014996178 6:128148059-128148081 CTTAGTGACCAGAAAAAGGGAGG + Intronic
1015602083 6:134920425-134920447 CTGTGTGAATAGGGGAATGGAGG + Intronic
1016053543 6:139554921-139554943 CTGAGGGTAGAGGAGAATGGGGG - Intergenic
1017402854 6:154084266-154084288 CTTAGTGAAGGGGAGAATGGAGG - Intronic
1019481652 7:1269809-1269831 CTGAGAGAGCTGGAGACTGGGGG - Intergenic
1019912053 7:4106706-4106728 TTGAGAGAGCAGGAGAGTGGGGG - Intronic
1022172995 7:27847388-27847410 CTTAGAGAACAGGAGAATGTGGG - Intronic
1022502676 7:30892502-30892524 GTGAGGCCCCAGGAGAATGGAGG + Intergenic
1022708916 7:32833633-32833655 CTAAGGGAGAAGGAGAATGGAGG - Intergenic
1023199130 7:37674724-37674746 CAGAGTGGCTGGGAGAATGGAGG + Intergenic
1023981780 7:45074634-45074656 TTGAGTTCCCAGGAGAATGAAGG - Intronic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1030187481 7:106777966-106777988 CTGAGAGACCAGGATAATGGAGG + Intergenic
1030470615 7:109958453-109958475 ATGAGTGACCTGGAGCATGGGGG + Intergenic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1032489496 7:132313531-132313553 CTGGGTGGCCAAGGGAATGGTGG + Intronic
1032901276 7:136311402-136311424 CTTAGTGACCAGGGCAATGAAGG - Intergenic
1033609259 7:142950301-142950323 CAGAGTGACTAGGACAATAGTGG - Intronic
1034198524 7:149266199-149266221 CTGAGTTAGCAGCAGACTGGGGG - Intronic
1035252938 7:157608940-157608962 CTGAGAGGCCAGGAAAATGTGGG + Intronic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1039419522 8:37424346-37424368 CTGAGCGACCCTGAGAATGGTGG - Intergenic
1039442950 8:37608024-37608046 CCGAGTGATCAGGAGTCTGGGGG + Intergenic
1041107134 8:54454529-54454551 CTGAGTGACCAGGCAAAGGCTGG - Intergenic
1041178769 8:55226477-55226499 CTCAATGTCCAGGAGAATGGTGG + Intronic
1041307043 8:56472350-56472372 CTCAGTGACCAAGAGAAGAGAGG + Intergenic
1041660980 8:60400787-60400809 CTGAGTAAATAGGAGAATTGTGG + Intergenic
1047425185 8:124739052-124739074 CTGAATGCCCAAGAGAATGGTGG + Intergenic
1048722246 8:137339101-137339123 CTGAGAGACTAGGAGACAGGAGG - Intergenic
1049414646 8:142489699-142489721 CGGAATGACCAGGCCAATGGGGG - Intronic
1050021710 9:1291566-1291588 CTGAGTGACAAGGAGACCTGTGG + Intergenic
1052337622 9:27336403-27336425 CTGAGACACCAGGAGAAAGGGGG + Intronic
1055398583 9:75899171-75899193 CCTTGGGACCAGGAGAATGGTGG + Intronic
1055717105 9:79129860-79129882 CTGAGAGACCAGAAAAAAGGCGG + Intergenic
1057817241 9:98304624-98304646 CTGCATGTCCAGGAGGATGGAGG + Intronic
1058708014 9:107653353-107653375 ATGAGTGACCAGGAGGGTGGAGG - Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059560841 9:115333322-115333344 CCCAGTGACCAGGAGAGTAGGGG + Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060627532 9:125127267-125127289 TTGAGGTACCAGGAGAAGGGTGG - Intronic
1062020172 9:134315680-134315702 CTGAGTCCCCAGAAGAAGGGAGG - Intergenic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1188400709 X:29740486-29740508 CTGAGTAACTAAGAGAATGATGG - Intronic
1188830825 X:34894675-34894697 GTGAGAGACCAGGAAAATAGAGG + Intergenic
1190327163 X:49213694-49213716 CTGAGTCTCCAGGAGTAGGGAGG + Intronic
1190388424 X:49908138-49908160 GTGAGTGAGGTGGAGAATGGTGG + Intergenic
1190509572 X:51162061-51162083 CTCAGTGTCCAGGAGCATGAGGG + Intergenic
1191169937 X:57433894-57433916 CTGAGCAACCAGGGGAATAGGGG - Intronic
1193848690 X:86508029-86508051 CTGACAGAACAGGAGAAGGGTGG + Intronic
1194993586 X:100570414-100570436 CCGTGTGAACAGCAGAATGGGGG - Intergenic
1195656551 X:107336788-107336810 CTAACCGACTAGGAGAATGGAGG + Intergenic
1196910196 X:120477113-120477135 CTGGGTGACTGGGAGAATGGTGG - Intergenic
1197284454 X:124579871-124579893 CTGAGTGACTAGAAAAATGTTGG + Intronic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198121233 X:133594233-133594255 CTCAGTGATCAGGAGAATGATGG + Intronic
1198326491 X:135578910-135578932 CTGAGTGCTCAGGAGAGTTGAGG - Intronic
1201304397 Y:12538115-12538137 ATGAGTGACAAGGAGATTGCAGG + Intergenic